Incidental Mutation 'R6355:Arhgap29'
ID512327
Institutional Source Beutler Lab
Gene Symbol Arhgap29
Ensembl Gene ENSMUSG00000039831
Gene NameRho GTPase activating protein 29
SynonymsB130017I01Rik, 6720461J18Rik, C76601, Parg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6355 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location121952541-122016753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122011258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 832 (D832G)
Ref Sequence ENSEMBL: ENSMUSP00000044624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037958
AA Change: D832G

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: D832G

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 5e-41 PDB
Blast:RhoGAP 412 595 9e-84 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 885 1.92e-68 SMART
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197155
SMART Domains Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
PDB:3QWE|A 193 469 8e-42 PDB
Blast:RhoGAP 412 595 2e-87 BLAST
C1 613 659 2.48e-6 SMART
RhoGAP 684 780 1.14e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000198914
AA Change: D424G
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T G 13: 30,381,499 F182L probably benign Het
Ahnak A G 19: 9,008,762 E2470G probably benign Het
Arhgap20 T C 9: 51,843,720 W418R probably damaging Het
Btbd2 A G 10: 80,645,349 F325L possibly damaging Het
Chrna10 A T 7: 102,113,085 probably null Het
Cyp26a1 T C 19: 37,698,929 I188T possibly damaging Het
Dnajc13 A G 9: 104,203,270 C871R probably damaging Het
Gm11639 T C 11: 105,005,685 S4287P probably benign Het
Gm5519 A T 19: 33,825,071 *171C probably null Het
Gnat1 C A 9: 107,677,424 V81F probably benign Het
Gorab G A 1: 163,386,569 A264V probably damaging Het
Ift172 A T 5: 31,284,157 V211E probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kif26b A C 1: 178,916,178 S1280R probably damaging Het
Lce3e C T 3: 92,967,735 probably benign Het
Magi1 A G 6: 94,283,196 Y43H probably benign Het
Mon2 T A 10: 123,022,920 M829L possibly damaging Het
Nmd3 G A 3: 69,729,347 V96I probably benign Het
Ogfod1 T C 8: 94,062,982 M437T probably benign Het
Olfr1036 T A 2: 86,074,872 I44K probably benign Het
Olfr1278 A G 2: 111,292,885 I206V probably benign Het
Olfr1416 T C 1: 92,479,980 T214A probably benign Het
Pabpc2 A G 18: 39,774,392 S237G probably damaging Het
Parp4 T A 14: 56,602,300 D488E possibly damaging Het
Phldb2 C T 16: 45,825,338 M293I probably damaging Het
Poc1b G A 10: 99,129,574 E80K probably damaging Het
Prdm5 C A 6: 65,883,594 Q421K probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Ralgapa1 A G 12: 55,698,854 S1239P probably damaging Het
Robo3 A G 9: 37,418,939 V1052A possibly damaging Het
Satb2 G T 1: 56,948,197 D83E probably damaging Het
Sccpdh T C 1: 179,670,600 S70P probably benign Het
Scn3a A G 2: 65,461,299 F1701S probably damaging Het
Srsf9 A G 5: 115,327,309 M1V probably null Het
Stk32a T A 18: 43,297,594 probably null Het
Sult2a5 A C 7: 13,662,537 Y183S probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnip2 G A 5: 34,499,197 Q255* probably null Het
Vmn1r26 A G 6: 58,008,551 W218R probably benign Het
Vmn2r61 A G 7: 42,267,235 Y424C probably benign Het
Vmn2r86 T A 10: 130,455,894 M1L probably damaging Het
Wnt3a A T 11: 59,275,232 I74N probably damaging Het
Zfyve1 A T 12: 83,594,641 H80Q probably benign Het
Other mutations in Arhgap29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Arhgap29 APN 3 122003312 nonsense probably null
IGL01121:Arhgap29 APN 3 122009863 missense probably damaging 1.00
IGL01622:Arhgap29 APN 3 121974124 splice site probably benign
IGL01623:Arhgap29 APN 3 121974124 splice site probably benign
IGL01995:Arhgap29 APN 3 122014328 missense probably benign 0.00
IGL02120:Arhgap29 APN 3 122004257 missense probably benign 0.05
IGL02554:Arhgap29 APN 3 121992524 unclassified probably benign
IGL02931:Arhgap29 APN 3 121992860 missense probably benign
IGL02937:Arhgap29 APN 3 121974049 missense probably damaging 0.99
PIT4362001:Arhgap29 UTSW 3 122003212 missense probably benign 0.42
R0022:Arhgap29 UTSW 3 121988937 missense possibly damaging 0.61
R0574:Arhgap29 UTSW 3 122007625 missense probably benign 0.01
R0601:Arhgap29 UTSW 3 121991110 missense probably damaging 1.00
R0639:Arhgap29 UTSW 3 122007641 missense probably damaging 1.00
R0881:Arhgap29 UTSW 3 122014679 missense probably damaging 1.00
R1232:Arhgap29 UTSW 3 122003340 missense probably damaging 1.00
R1295:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1296:Arhgap29 UTSW 3 121992395 missense probably benign 0.27
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1403:Arhgap29 UTSW 3 121973929 missense probably damaging 1.00
R1470:Arhgap29 UTSW 3 121992319 unclassified probably benign
R1710:Arhgap29 UTSW 3 122008080 missense probably damaging 1.00
R1878:Arhgap29 UTSW 3 122011371 missense probably damaging 1.00
R2051:Arhgap29 UTSW 3 121981860 missense probably benign 0.01
R2112:Arhgap29 UTSW 3 122011561 missense probably benign 0.03
R2188:Arhgap29 UTSW 3 121991009 missense probably damaging 1.00
R2240:Arhgap29 UTSW 3 122011453 missense probably benign 0.12
R2420:Arhgap29 UTSW 3 121973980 missense probably benign
R3618:Arhgap29 UTSW 3 121988527 missense possibly damaging 0.62
R4673:Arhgap29 UTSW 3 122014971 missense probably damaging 1.00
R4717:Arhgap29 UTSW 3 122009958 missense possibly damaging 0.82
R5028:Arhgap29 UTSW 3 122010060 critical splice donor site probably null
R5043:Arhgap29 UTSW 3 121974004 missense probably benign 0.00
R5045:Arhgap29 UTSW 3 122002595 missense probably benign 0.28
R5463:Arhgap29 UTSW 3 121988551 missense possibly damaging 0.94
R5495:Arhgap29 UTSW 3 122014929 missense probably damaging 1.00
R5743:Arhgap29 UTSW 3 121981911 missense probably damaging 1.00
R5791:Arhgap29 UTSW 3 122014245 missense probably damaging 0.98
R5896:Arhgap29 UTSW 3 122012087 missense possibly damaging 0.78
R6083:Arhgap29 UTSW 3 121992748 missense probably benign 0.00
R6451:Arhgap29 UTSW 3 121993581 missense probably damaging 1.00
R6528:Arhgap29 UTSW 3 122014702 missense probably benign 0.13
R7239:Arhgap29 UTSW 3 121988950 missense probably benign 0.16
R7669:Arhgap29 UTSW 3 121992812 missense probably damaging 1.00
R7807:Arhgap29 UTSW 3 122014332 missense probably benign 0.01
R8048:Arhgap29 UTSW 3 121992901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCAGGCAGCCAACATG -3'
(R):5'- ATCAACCTGAGGTGCCACAG -3'

Sequencing Primer
(F):5'- CAGCCAACATGGTACCTTAGGTG -3'
(R):5'- GCACCTGTGTTAGATATAACAACAGC -3'
Posted On2018-04-27