Incidental Mutation 'R6355:Stk32a'
ID512356
Institutional Source Beutler Lab
Gene Symbol Stk32a
Ensembl Gene ENSMUSG00000039954
Gene Nameserine/threonine kinase 32A
SynonymsYANK1, A930015B13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6355 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location43207697-43317481 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 43297594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045477]
Predicted Effect probably null
Transcript: ENSMUST00000045477
SMART Domains Protein: ENSMUSP00000038471
Gene: ENSMUSG00000039954

DomainStartEndE-ValueType
S_TKc 23 281 9.58e-85 SMART
low complexity region 318 339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1a T G 13: 30,381,499 F182L probably benign Het
Ahnak A G 19: 9,008,762 E2470G probably benign Het
Arhgap20 T C 9: 51,843,720 W418R probably damaging Het
Arhgap29 A G 3: 122,011,258 D832G possibly damaging Het
Btbd2 A G 10: 80,645,349 F325L possibly damaging Het
Chrna10 A T 7: 102,113,085 probably null Het
Cyp26a1 T C 19: 37,698,929 I188T possibly damaging Het
Dnajc13 A G 9: 104,203,270 C871R probably damaging Het
Gm11639 T C 11: 105,005,685 S4287P probably benign Het
Gm5519 A T 19: 33,825,071 *171C probably null Het
Gnat1 C A 9: 107,677,424 V81F probably benign Het
Gorab G A 1: 163,386,569 A264V probably damaging Het
Ift172 A T 5: 31,284,157 V211E probably benign Het
Ivl CCTGCTGCTGCTGCT CCTGCTGCTGCT 3: 92,571,910 probably benign Het
Kif26b A C 1: 178,916,178 S1280R probably damaging Het
Lce3e C T 3: 92,967,735 probably benign Het
Magi1 A G 6: 94,283,196 Y43H probably benign Het
Mon2 T A 10: 123,022,920 M829L possibly damaging Het
Nmd3 G A 3: 69,729,347 V96I probably benign Het
Ogfod1 T C 8: 94,062,982 M437T probably benign Het
Olfr1036 T A 2: 86,074,872 I44K probably benign Het
Olfr1278 A G 2: 111,292,885 I206V probably benign Het
Olfr1416 T C 1: 92,479,980 T214A probably benign Het
Pabpc2 A G 18: 39,774,392 S237G probably damaging Het
Parp4 T A 14: 56,602,300 D488E possibly damaging Het
Phldb2 C T 16: 45,825,338 M293I probably damaging Het
Poc1b G A 10: 99,129,574 E80K probably damaging Het
Prdm5 C A 6: 65,883,594 Q421K probably damaging Het
Rad54b A G 4: 11,604,989 E479G possibly damaging Het
Ralgapa1 A G 12: 55,698,854 S1239P probably damaging Het
Robo3 A G 9: 37,418,939 V1052A possibly damaging Het
Satb2 G T 1: 56,948,197 D83E probably damaging Het
Sccpdh T C 1: 179,670,600 S70P probably benign Het
Scn3a A G 2: 65,461,299 F1701S probably damaging Het
Srsf9 A G 5: 115,327,309 M1V probably null Het
Sult2a5 A C 7: 13,662,537 Y183S probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnip2 G A 5: 34,499,197 Q255* probably null Het
Vmn1r26 A G 6: 58,008,551 W218R probably benign Het
Vmn2r61 A G 7: 42,267,235 Y424C probably benign Het
Vmn2r86 T A 10: 130,455,894 M1L probably damaging Het
Wnt3a A T 11: 59,275,232 I74N probably damaging Het
Zfyve1 A T 12: 83,594,641 H80Q probably benign Het
Other mutations in Stk32a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Stk32a APN 18 43310445 missense possibly damaging 0.46
IGL00704:Stk32a APN 18 43261249 missense probably damaging 1.00
IGL00813:Stk32a APN 18 43310520 missense probably benign 0.10
IGL02121:Stk32a APN 18 43313507 missense probably benign
IGL02407:Stk32a APN 18 43297511 missense probably benign 0.00
IGL02957:Stk32a APN 18 43311992 missense probably benign
R0004:Stk32a UTSW 18 43305056 missense probably damaging 1.00
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0047:Stk32a UTSW 18 43313378 splice site probably benign
R0288:Stk32a UTSW 18 43304995 splice site probably null
R0330:Stk32a UTSW 18 43313501 missense probably benign 0.15
R1337:Stk32a UTSW 18 43261349 missense probably benign 0.00
R1559:Stk32a UTSW 18 43243084 missense probably benign 0.32
R1695:Stk32a UTSW 18 43313420 nonsense probably null
R1874:Stk32a UTSW 18 43261316 missense probably damaging 1.00
R1954:Stk32a UTSW 18 43212025 missense probably benign 0.45
R4529:Stk32a UTSW 18 43242979 missense possibly damaging 0.83
R4980:Stk32a UTSW 18 43314048 missense probably benign 0.01
R5124:Stk32a UTSW 18 43305017 missense probably benign 0.00
R5751:Stk32a UTSW 18 43305020 missense possibly damaging 0.74
R5822:Stk32a UTSW 18 43313487 missense probably benign 0.00
R5863:Stk32a UTSW 18 43315144 missense probably benign 0.00
R6167:Stk32a UTSW 18 43313409 missense probably damaging 1.00
R6731:Stk32a UTSW 18 43305078 missense probably damaging 1.00
R7162:Stk32a UTSW 18 43297584 nonsense probably null
R8001:Stk32a UTSW 18 43315144 missense possibly damaging 0.62
R8022:Stk32a UTSW 18 43315101 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTACTCAGTTGCAGCTAG -3'
(R):5'- GCCTCAGCCTCATTTCAGAC -3'

Sequencing Primer
(F):5'- AAGCATCCGGGTCTTTTCAG -3'
(R):5'- TCAGCCTCATTTCAGACCATTAAATC -3'
Posted On2018-04-27