Incidental Mutation 'R6357:Esam'
ID512382
Institutional Source Beutler Lab
Gene Symbol Esam
Ensembl Gene ENSMUSG00000001946
Gene Nameendothelial cell-specific adhesion molecule
Synonyms2310008D05Rik, W117m
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6357 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37528078-37538319 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 37537780 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 395 (*395R)
Ref Sequence ENSEMBL: ENSMUSP00000002011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002008] [ENSMUST00000002011] [ENSMUST00000123198] [ENSMUST00000146860] [ENSMUST00000213699] [ENSMUST00000214142] [ENSMUST00000215271] [ENSMUST00000215957]
Predicted Effect probably benign
Transcript: ENSMUST00000002008
SMART Domains Protein: ENSMUSP00000002008
Gene: ENSMUSG00000001943

DomainStartEndE-ValueType
IGv 41 124 4.03e-8 SMART
IGc2 158 225 1.06e-7 SMART
transmembrane domain 243 265 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000002011
AA Change: *395R
SMART Domains Protein: ENSMUSP00000002011
Gene: ENSMUSG00000001946
AA Change: *395R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 39 153 4.82e-6 SMART
IGc2 168 234 1.17e-4 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123198
SMART Domains Protein: ENSMUSP00000116300
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
Blast:IG 9 72 1e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131832
Predicted Effect probably benign
Transcript: ENSMUST00000146860
SMART Domains Protein: ENSMUSP00000122473
Gene: ENSMUSG00000001946

DomainStartEndE-ValueType
IG 9 123 4.82e-6 SMART
IGc2 138 204 1.17e-4 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213502
Predicted Effect probably benign
Transcript: ENSMUST00000213699
Predicted Effect probably benign
Transcript: ENSMUST00000214142
Predicted Effect probably benign
Transcript: ENSMUST00000215271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215710
Predicted Effect probably benign
Transcript: ENSMUST00000215957
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhbit a decrease in body weight, impaired neutrophil transmigration and decreased immune and VEGF-stimulated vascular permeability. Tumor growth is inhibited due to decreased pathological angiogenesis in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nefl A G 14: 68,084,318 E119G probably damaging Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Esam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03180:Esam APN 9 37534570 missense probably damaging 0.99
IGL03408:Esam APN 9 37534653 missense possibly damaging 0.52
R0755:Esam UTSW 9 37536702 missense probably damaging 0.98
R1657:Esam UTSW 9 37537621 missense probably damaging 1.00
R2349:Esam UTSW 9 37528231 missense probably benign
R3418:Esam UTSW 9 37537130 splice site probably null
R4373:Esam UTSW 9 37534196 missense probably benign
R4669:Esam UTSW 9 37536656 nonsense probably null
R6175:Esam UTSW 9 37528248 missense probably benign 0.01
R7293:Esam UTSW 9 37537724 missense probably damaging 1.00
R7472:Esam UTSW 9 37537567 missense possibly damaging 0.77
R8043:Esam UTSW 9 37537021 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACCTGGCACATTTACTCCC -3'
(R):5'- GAAGTGAAGCCTCCTCACTC -3'

Sequencing Primer
(F):5'- CACACCCAGTGTCTCTAGC -3'
(R):5'- GTCCTTTGACCCAGATTTTAGTC -3'
Posted On2018-04-27