Incidental Mutation 'R6357:Nefl'
ID512396
Institutional Source Beutler Lab
Gene Symbol Nefl
Ensembl Gene ENSMUSG00000022055
Gene Nameneurofilament, light polypeptide
SynonymsNfl, CMT2E, NF68, NF-L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6357 (G1)
Quality Score215.009
Status Not validated
Chromosome14
Chromosomal Location68083863-68089095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68084318 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 119 (E119G)
Ref Sequence ENSEMBL: ENSMUSP00000022639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022639] [ENSMUST00000111089]
Predicted Effect probably damaging
Transcript: ENSMUST00000022639
AA Change: E119G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022639
Gene: ENSMUSG00000022055
AA Change: E119G

DomainStartEndE-ValueType
Pfam:Filament_head 9 88 7e-14 PFAM
Filament 89 400 6.93e-139 SMART
low complexity region 448 470 N/A INTRINSIC
coiled coil region 473 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111089
SMART Domains Protein: ENSMUSP00000106718
Gene: ENSMUSG00000022054

DomainStartEndE-ValueType
Pfam:Filament_head 9 97 1.6e-16 PFAM
Pfam:Filament 98 403 1.1e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 97.8%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and they functionally maintain the neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the light chain neurofilament protein. Mutations in this gene cause Charcot-Marie-Tooth disease types 1F (CMT1F) and 2E (CMT2E), disorders of the peripheral nervous system that are characterized by distinct neuropathies. A pseudogene has been identified on chromosome Y. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene lack neurofilaments in their axons and have motor axons that are reduced in both size and number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,930,974 M303V probably benign Het
1700061G19Rik T C 17: 56,877,591 probably null Het
3632451O06Rik A T 14: 49,773,312 S313T probably benign Het
Calcr T C 6: 3,714,710 D140G probably benign Het
Card10 T C 15: 78,799,379 E188G probably damaging Het
Cenpq T C 17: 40,924,527 E193G probably damaging Het
Cep164 G A 9: 45,770,884 L1874F probably damaging Het
Dennd3 T C 15: 73,556,472 M889T possibly damaging Het
Dnah9 T C 11: 65,874,196 K3841E probably damaging Het
Eci2 A G 13: 34,993,099 V26A possibly damaging Het
Eftud2 A T 11: 102,864,780 N200K probably damaging Het
Eml5 T A 12: 98,870,884 H357L probably damaging Het
Esam T C 9: 37,537,780 *395R probably null Het
Fam205a1 T A 4: 42,850,393 I588F probably damaging Het
Galt C T 4: 41,757,565 P246S probably benign Het
Gjb3 A T 4: 127,326,630 Y36* probably null Het
Gli2 T C 1: 118,841,959 E621G probably damaging Het
Gls T C 1: 52,219,506 D201G probably damaging Het
Gm10801 C CGTCA 2: 98,663,807 probably null Het
Gm1110 T C 9: 26,914,128 probably null Het
Gm5565 T A 5: 146,160,473 H13L possibly damaging Het
Hydin A C 8: 110,541,657 T2923P possibly damaging Het
Kank1 A T 19: 25,411,353 I797L probably benign Het
Klhdc8a A T 1: 132,303,153 Q252L probably damaging Het
Kmt5c T C 7: 4,742,205 F65S possibly damaging Het
Lix1 C T 17: 17,445,993 P138L probably benign Het
Lnpep T C 17: 17,552,914 N664S probably benign Het
Msh6 T A 17: 87,984,460 Y214* probably null Het
Nptxr C A 15: 79,794,315 R257L possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr866 T A 9: 20,027,629 Q103L probably damaging Het
Oxct2b A G 4: 123,116,916 I210V probably benign Het
Plppr3 T A 10: 79,865,406 Q534L probably benign Het
Psma1 T C 7: 114,274,367 probably null Het
Rbp3 G A 14: 33,957,034 A980T probably damaging Het
Ripply2 T A 9: 87,016,278 S58R possibly damaging Het
Robo1 T C 16: 72,970,302 V454A probably benign Het
Sacs A G 14: 61,208,824 D2773G possibly damaging Het
Sirpb1b A T 3: 15,503,183 V366E possibly damaging Het
Slc5a7 T C 17: 54,287,361 I197M probably benign Het
Srgap2 T C 1: 131,355,542 Y267C probably damaging Het
Ssc4d T C 5: 135,966,096 T189A probably benign Het
Tas2r106 A G 6: 131,677,962 *309Q probably null Het
Tctex1d2 T G 16: 32,429,055 probably null Het
Theg T C 10: 79,586,955 S38G probably benign Het
Vmn2r44 T C 7: 8,370,658 M511V probably benign Het
Wdfy4 G T 14: 33,101,049 Y1364* probably null Het
Zbtb8a T C 4: 129,354,299 H393R probably benign Het
Other mutations in Nefl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Nefl APN 14 68086482 intron probably benign
IGL01755:Nefl APN 14 68086077 missense probably damaging 1.00
IGL02825:Nefl APN 14 68084346 missense possibly damaging 0.96
IGL03297:Nefl APN 14 68084224 missense possibly damaging 0.55
PIT4418001:Nefl UTSW 14 68086530 missense probably damaging 0.99
R0503:Nefl UTSW 14 68083983 missense probably benign 0.08
R1837:Nefl UTSW 14 68086626 missense probably damaging 1.00
R1970:Nefl UTSW 14 68086672 missense probably benign 0.20
R4812:Nefl UTSW 14 68084285 missense probably damaging 1.00
R4972:Nefl UTSW 14 68086763 intron probably benign
R5361:Nefl UTSW 14 68084639 missense probably damaging 0.99
R6499:Nefl UTSW 14 68084585 missense probably damaging 1.00
R7571:Nefl UTSW 14 68084674 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGCTCTTTGATGCCCAG -3'
(R):5'- GAAAGCTATCTCGTCCATCAGGC -3'

Sequencing Primer
(F):5'- AGCCTGGAGAATCTCGATCTG -3'
(R):5'- TCGTCCATCAGGCTGTCGATG -3'
Posted On2018-04-27