Mutagenetix > Incidental Mutation

Incidental Mutation 'R6349:Adgrd1'

512428

Institutional Source

Beutler Lab

Gene Symbol

Adgrd1

Ensembl Gene

ENSMUSG00000044017

Gene Name

adhesion G protein-coupled receptor D1

Synonyms

E230012M21Rik, Gpr133

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6349 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

129096750-129204599 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to C at 129142539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056617] [ENSMUST00000156437]

AlphaFold

Q80T32

Predicted Effect

probably null
Transcript: ENSMUST00000056617

SMART Domains

Protein: ENSMUSP00000060307
Gene: ENSMUSG00000044017

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Laminin_G_3	119	273	2.9e-18	PFAM
Pfam:Pentaxin	171	288	2.2e-7	PFAM
GPS	535	585	1.57e-14	SMART
Pfam:Dicty_CAR	590	856	1.2e-8	PFAM
Pfam:7tm_2	592	831	8e-58	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000156437

SMART Domains

Protein: ENSMUSP00000121217
Gene: ENSMUSG00000044017

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The adhesion G-protein-coupled receptors (GPCRs), including GPR133, are membrane-bound proteins with long N termini containing multiple domains. GPCRs, or GPRs, contain 7 transmembrane domains and transduce extracellular signals through heterotrimeric G proteins (summary by Bjarnadottir et al., 2004 [PubMed 15203201]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012A03Rik	A	G	6: 32,051,660	Y9C	probably benign	Het
4930433I11Rik	A	C	7: 40,994,772	M622L	possibly damaging	Het
Abca8b	C	T	11: 109,934,718		probably null	Het
Adam28	T	C	14: 68,633,172	I351V	probably benign	Het
Ank3	T	A	10: 69,979,439	I473N	probably damaging	Het
Ankrd6	A	T	4: 32,822,231	H179Q	probably damaging	Het
Ano6	A	G	15: 95,966,022	R808G	probably damaging	Het
Anxa8	A	T	14: 34,097,893	I280F	probably damaging	Het
Asb2	C	T	12: 103,345,859	M1I	probably null	Het
Astn1	C	T	1: 158,664,121	Q1023*	probably null	Het
Cast	T	A	13: 74,721,195	E542D	probably damaging	Het
Ccdc162	C	T	10: 41,694,400	E30K	probably damaging	Het
Ccdc87	T	C	19: 4,841,319	V613A	probably damaging	Het
Cdk13	T	C	13: 17,751,719	N832S	probably damaging	Het
Celsr1	T	A	15: 86,031,684	N696I	probably damaging	Het
Chd3	T	C	11: 69,364,031	E161G	possibly damaging	Het
Cxcr4	C	A	1: 128,589,277	V216F	possibly damaging	Het
Cyp4a10	A	G	4: 115,525,358	I282V	probably benign	Het
Deaf1	T	C	7: 141,322,950	T154A	possibly damaging	Het
Dido1	A	T	2: 180,660,701	D1803E	probably benign	Het
Dmxl2	T	C	9: 54,419,909	D944G	possibly damaging	Het
Dnah5	G	A	15: 28,238,511	V400M	probably damaging	Het
Fbxo15	A	G	18: 84,964,142	I240V	probably benign	Het
Fcrls	A	G	3: 87,252,496	C484R	probably damaging	Het
Fech	G	T	18: 64,470,785	Y164*	probably null	Het
Fer1l5	T	A	1: 36,411,274	W1175R	probably damaging	Het
Fgfrl1	T	C	5: 108,705,506	Y241H	probably damaging	Het
Flvcr2	T	C	12: 85,747,200	Y117H	probably benign	Het
Fsip2	T	A	2: 82,993,072	M6383K	probably benign	Het
Gcc2	T	A	10: 58,269,474	D141E	probably benign	Het
Glt1d1	A	C	5: 127,706,886	R301S	probably benign	Het
Hars	G	C	18: 36,783,054	A16G	probably benign	Het
Hmcn2	G	T	2: 31,388,373	G1696C	probably damaging	Het
Hydin	T	A	8: 110,418,459	L814*	probably null	Het
Izumo4	T	A	10: 80,702,717	M1K	probably null	Het
Kdm5d	T	A	Y: 916,847	M414K	probably damaging	Homo
Kif21b	G	A	1: 136,158,326	V812I	probably damaging	Het
Map3k7	A	G	4: 31,988,661	D270G	possibly damaging	Het
Mical3	A	G	6: 120,959,525	S1347P	probably benign	Het
Mras	T	A	9: 99,394,616	D67V	probably damaging	Het
Mtnr1b	A	T	9: 15,863,213	Y183*	probably null	Het
Muc16	A	T	9: 18,657,329	L1298Q	unknown	Het
Myh2	A	T	11: 67,193,003	I1536F	probably benign	Het
Olfr371	T	C	8: 85,231,158	I221T	possibly damaging	Het
Osmr	G	T	15: 6,821,063	D686E	probably benign	Het
Pah	T	A	10: 87,578,969	D394E	probably benign	Het
Pla1a	T	A	16: 38,417,124	S71C	probably benign	Het
Proc	T	A	18: 32,133,433	I114L	probably benign	Het
Psd	T	G	19: 46,313,387		probably null	Het
Psmb6	C	T	11: 70,527,538	Q226*	probably null	Het
Rnpepl1	A	T	1: 92,919,841	N717Y	probably damaging	Het
Rundc1	T	C	11: 101,434,162	S565P	probably benign	Het
Serpinb5	T	A	1: 106,881,765	S300R	probably benign	Het
Serpinf2	T	C	11: 75,432,431	D483G	probably damaging	Het
Sgsm3	T	C	15: 81,008,346	I291T	probably benign	Het
Smg6	T	A	11: 75,053,774	D116E	possibly damaging	Het
Srfbp1	G	T	18: 52,488,962	S365I	probably benign	Het
Stkld1	A	G	2: 26,945,860	T236A	probably benign	Het
Susd5	T	C	9: 114,095,802	V251A	probably benign	Het
Tcf25	A	G	8: 123,391,593	Y314C	probably damaging	Het
Tmem210	A	G	2: 25,289,036	D112G	possibly damaging	Het
Tubb2b	A	G	13: 34,127,545	Y422H	probably damaging	Het
Tyw1	T	C	5: 130,277,031	S332P	possibly damaging	Het
Vmn1r29	A	C	6: 58,307,427	Q44P	probably damaging	Het
Vrtn	T	C	12: 84,649,018	S181P	probably damaging	Het
Wdr76	T	A	2: 121,534,231	Y437N	possibly damaging	Het
Zc3h18	C	A	8: 122,408,286		probably benign	Het
Zfp287	G	T	11: 62,725,342	D174E	probably damaging	Het
Zfp800	A	T	6: 28,244,602	Y121*	probably null	Het
Zfyve19	T	A	2: 119,210,597	L57Q	probably damaging	Het

Other mutations in Adgrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Adgrd1	APN	5	129139592	missense	probably benign	0.06
IGL01384:Adgrd1	APN	5	129097209	missense	possibly damaging	0.47
IGL01636:Adgrd1	APN	5	129142452	splice site	probably benign
IGL01916:Adgrd1	APN	5	129132838	missense	probably benign	0.12
IGL01923:Adgrd1	APN	5	129178079	missense	possibly damaging	0.58
IGL02019:Adgrd1	APN	5	129115138	missense	probably benign	0.00
IGL02142:Adgrd1	APN	5	129131584	missense	probably benign
IGL02149:Adgrd1	APN	5	129179261	missense	probably damaging	1.00
IGL02190:Adgrd1	APN	5	129140724	splice site	probably benign
IGL02623:Adgrd1	APN	5	129132745	missense	probably damaging	0.99
IGL02696:Adgrd1	APN	5	129140854	splice site	probably benign
IGL02850:Adgrd1	APN	5	129115055	missense	probably damaging	1.00
IGL02976:Adgrd1	APN	5	129131597	missense	probably benign	0.00
IGL02988:Adgrd1	UTSW	5	129144010	missense	probably benign	0.00
PIT4458001:Adgrd1	UTSW	5	129131577	missense	probably damaging	1.00
R0081:Adgrd1	UTSW	5	129178082	missense	probably damaging	0.99
R0266:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0267:Adgrd1	UTSW	5	129139594	missense	probably benign	0.00
R0464:Adgrd1	UTSW	5	129162650	missense	probably damaging	1.00
R0625:Adgrd1	UTSW	5	129171931	critical splice donor site	probably null
R1288:Adgrd1	UTSW	5	129129007	missense	probably damaging	0.97
R1460:Adgrd1	UTSW	5	129122563	missense	possibly damaging	0.63
R1635:Adgrd1	UTSW	5	129128907	missense	probably damaging	1.00
R1658:Adgrd1	UTSW	5	129178100	missense	probably benign	0.02
R1709:Adgrd1	UTSW	5	129179228	missense	possibly damaging	0.95
R1897:Adgrd1	UTSW	5	129129001	missense	probably benign	0.01
R1976:Adgrd1	UTSW	5	129140797	missense	probably benign	0.06
R2049:Adgrd1	UTSW	5	129115095	missense	probably benign	0.01
R2259:Adgrd1	UTSW	5	129112311	missense	possibly damaging	0.92
R2295:Adgrd1	UTSW	5	129122506	missense	probably benign	0.13
R3076:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3077:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R3078:Adgrd1	UTSW	5	129129105	missense	probably benign	0.20
R4581:Adgrd1	UTSW	5	129202531	missense	possibly damaging	0.68
R5024:Adgrd1	UTSW	5	129171895	missense	probably damaging	1.00
R5076:Adgrd1	UTSW	5	129143989	nonsense	probably null
R5227:Adgrd1	UTSW	5	129122583	missense	probably benign	0.00
R5453:Adgrd1	UTSW	5	129179583	missense	probably damaging	0.99
R6953:Adgrd1	UTSW	5	129115078	nonsense	probably null
R7300:Adgrd1	UTSW	5	129097347	critical splice donor site	probably null
R7583:Adgrd1	UTSW	5	129179588	missense	probably benign	0.42
R7622:Adgrd1	UTSW	5	129139624	missense	probably benign	0.27
R8205:Adgrd1	UTSW	5	129115111	missense	possibly damaging	0.94
R8716:Adgrd1	UTSW	5	129188371	missense	possibly damaging	0.94
R8780:Adgrd1	UTSW	5	129097074	start gained	probably benign
R8850:Adgrd1	UTSW	5	129142510	missense	probably benign	0.00
R9528:Adgrd1	UTSW	5	129179676	missense	probably benign	0.44
R9569:Adgrd1	UTSW	5	129179637	missense	possibly damaging	0.90
R9626:Adgrd1	UTSW	5	129198657	missense	probably damaging	1.00
X0067:Adgrd1	UTSW	5	129188352	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- AAATGTCATGGTCTTGTGGCTC -3'
(R):5'- CTTCTCCAAAGGACTCGAAGC -3'

Sequencing Primer
(F):5'- CGACCCCGAGTCACTGC -3'
(R):5'- CCCAACCTGGCTTGAACAAGG -3'

Posted On

2018-04-27