Incidental Mutation 'R6349:Deaf1'
ID512435
Institutional Source Beutler Lab
Gene Symbol Deaf1
Ensembl Gene ENSMUSG00000058886
Gene NameDEAF1, transcription factor
SynonymsC230009B13Rik, suppressin, NUDR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141297180-141327690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141322950 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000147728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080553] [ENSMUST00000126510] [ENSMUST00000145184] [ENSMUST00000209397] [ENSMUST00000209608] [ENSMUST00000210816] [ENSMUST00000210830] [ENSMUST00000211537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080553
AA Change: T154A

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886
AA Change: T154A

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126510
SMART Domains Protein: ENSMUSP00000123330
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
Pfam:Transmemb_17 1 109 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145184
SMART Domains Protein: ENSMUSP00000117633
Gene: ENSMUSG00000025505

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:Transmemb_17 25 78 5.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155657
Predicted Effect probably benign
Transcript: ENSMUST00000209397
Predicted Effect probably benign
Transcript: ENSMUST00000209608
Predicted Effect unknown
Transcript: ENSMUST00000210062
AA Change: T128A
Predicted Effect probably benign
Transcript: ENSMUST00000210816
Predicted Effect probably benign
Transcript: ENSMUST00000210830
AA Change: T154A

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211537
AA Change: T154A

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit frequent exencephaly associated with neonatal lethality, rib cage abnormalities, and a low frequency of homeotic transformations of cervical segments but no presphenoid bone or cranial nerve defects; non-exencephalic survivors are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Deaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Deaf1 APN 7 141324181 critical splice acceptor site probably null
IGL02393:Deaf1 APN 7 141313333 missense possibly damaging 0.95
IGL03108:Deaf1 APN 7 141322961 missense probably damaging 1.00
IGL03344:Deaf1 APN 7 141297548 missense probably benign 0.08
Qball UTSW 7 141322468 missense probably damaging 1.00
R1543:Deaf1 UTSW 7 141324147 missense possibly damaging 0.65
R1702:Deaf1 UTSW 7 141314954 missense probably damaging 1.00
R2849:Deaf1 UTSW 7 141314454 makesense probably null
R4600:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4611:Deaf1 UTSW 7 141310971 missense possibly damaging 0.59
R4649:Deaf1 UTSW 7 141297573 missense possibly damaging 0.59
R4953:Deaf1 UTSW 7 141322468 missense probably damaging 1.00
R7168:Deaf1 UTSW 7 141324596 intron probably benign
R7186:Deaf1 UTSW 7 141327470 missense probably benign
R7343:Deaf1 UTSW 7 141322958 missense probably damaging 1.00
R7407:Deaf1 UTSW 7 141297579 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAGTGCCAACCCTTCAGTGG -3'
(R):5'- TCCTCTCTTGCTGATAAGTGAC -3'

Sequencing Primer
(F):5'- AGTGGGCAGCACTCCTTCTC -3'
(R):5'- CTAGTGTCTTGCAGTAGGGCCAC -3'
Posted On2018-04-27