Incidental Mutation 'R6349:Zfp287'
ID512450
Institutional Source Beutler Lab
Gene Symbol Zfp287
Ensembl Gene ENSMUSG00000005267
Gene Namezinc finger protein 287
SynonymsB230333C16Rik, SKAT-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location62700356-62731905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 62725342 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 174 (D174E)
Ref Sequence ENSEMBL: ENSMUSP00000141046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005399] [ENSMUST00000128370] [ENSMUST00000149228] [ENSMUST00000150336] [ENSMUST00000185656]
Predicted Effect probably damaging
Transcript: ENSMUST00000005399
AA Change: D163E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005399
Gene: ENSMUSG00000005267
AA Change: D163E

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
low complexity region 253 262 N/A INTRINSIC
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 2.61e-4 SMART
ZnF_C2H2 411 433 5.59e-4 SMART
ZnF_C2H2 439 461 3.44e-4 SMART
ZnF_C2H2 467 489 9.73e-4 SMART
ZnF_C2H2 495 517 2.43e-4 SMART
ZnF_C2H2 523 545 4.54e-4 SMART
ZnF_C2H2 551 573 2.57e-3 SMART
ZnF_C2H2 579 601 4.87e-4 SMART
ZnF_C2H2 607 629 1.3e-4 SMART
ZnF_C2H2 635 657 4.79e-3 SMART
ZnF_C2H2 663 685 2.95e-3 SMART
ZnF_C2H2 691 713 3.63e-3 SMART
ZnF_C2H2 719 741 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127732
Predicted Effect possibly damaging
Transcript: ENSMUST00000128370
AA Change: D163E

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117179
Gene: ENSMUSG00000005267
AA Change: D163E

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149228
AA Change: D174E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114531
Gene: ENSMUSG00000005267
AA Change: D174E

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150336
AA Change: D174E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121717
Gene: ENSMUSG00000005267
AA Change: D174E

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185656
AA Change: D174E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141046
Gene: ENSMUSG00000005267
AA Change: D174E

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Zfp287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp287 APN 11 62713890 nonsense probably null
IGL01868:Zfp287 APN 11 62715257 missense probably benign 0.22
IGL03290:Zfp287 APN 11 62715236 missense probably damaging 0.98
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0193:Zfp287 UTSW 11 62715029 missense probably benign 0.12
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0525:Zfp287 UTSW 11 62715244 missense probably benign
R0725:Zfp287 UTSW 11 62714213 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1416:Zfp287 UTSW 11 62714340 missense probably damaging 1.00
R1487:Zfp287 UTSW 11 62725289 missense probably damaging 1.00
R2023:Zfp287 UTSW 11 62714982 nonsense probably null
R2045:Zfp287 UTSW 11 62727569 missense probably damaging 1.00
R2495:Zfp287 UTSW 11 62714633 missense probably damaging 1.00
R3794:Zfp287 UTSW 11 62714244 missense probably damaging 1.00
R3902:Zfp287 UTSW 11 62712202 missense probably benign 0.00
R4816:Zfp287 UTSW 11 62714248 missense probably damaging 1.00
R4928:Zfp287 UTSW 11 62714136 nonsense probably null
R5048:Zfp287 UTSW 11 62714951 missense probably damaging 0.98
R5858:Zfp287 UTSW 11 62714007 missense probably damaging 1.00
R6964:Zfp287 UTSW 11 62724817 missense probably damaging 1.00
R7024:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R7252:Zfp287 UTSW 11 62724829 missense probably damaging 1.00
R7318:Zfp287 UTSW 11 62714278 missense probably damaging 1.00
R7548:Zfp287 UTSW 11 62713875 nonsense probably null
R7658:Zfp287 UTSW 11 62725263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGCCTAACCTCATGTTTAGC -3'
(R):5'- TCAGTCATAGACCAGATGAGGG -3'

Sequencing Primer
(F):5'- GCCTAACCTCATGTTTAGCAAGGAG -3'
(R):5'- GTTAAGACAGGTCTCACCATGTAGC -3'
Posted On2018-04-27