Incidental Mutation 'R6349:Serpinf2'
ID512455
Institutional Source Beutler Lab
Gene Symbol Serpinf2
Ensembl Gene ENSMUSG00000038224
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 2
Synonymsalpha 2 antiplasmin, Pli
MMRRC Submission
Accession Numbers

Genbank: NM_008878; MGI: 107173

Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R6349 (G1)
Quality Score121.008
Status Not validated
Chromosome11
Chromosomal Location75431732-75439591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75432431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 483 (D483G)
Ref Sequence ENSEMBL: ENSMUSP00000104076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043696] [ENSMUST00000108437] [ENSMUST00000128330] [ENSMUST00000142094]
Predicted Effect probably damaging
Transcript: ENSMUST00000043696
AA Change: D483G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048704
Gene: ENSMUSG00000038224
AA Change: D483G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108437
AA Change: D483G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104076
Gene: ENSMUSG00000038224
AA Change: D483G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119634
Predicted Effect probably benign
Transcript: ENSMUST00000128330
SMART Domains Protein: ENSMUSP00000114450
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 280 1.07e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142094
SMART Domains Protein: ENSMUSP00000120812
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of serine protease inhibitors. The protein is a major inhibitor of plasmin, which degrades fibrin and various other proteins. Consequently, the proper function of this gene has a major role in regulating the blood clotting pathway. Mutations in this gene result in alpha-2-plasmin inhibitor deficiency, which is characterized by severe hemorrhagic diathesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have an essentially normal phenotype. Spontaneous lysis of blood clots occurs more readily but bleeding times are unaffected. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Serpinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Serpinf2 APN 11 75436507 missense possibly damaging 0.58
IGL01367:Serpinf2 APN 11 75438045 missense probably benign
IGL01382:Serpinf2 APN 11 75438037 unclassified probably benign
R0122:Serpinf2 UTSW 11 75436546 missense probably damaging 1.00
R0135:Serpinf2 UTSW 11 75436393 missense probably damaging 1.00
R1864:Serpinf2 UTSW 11 75437483 missense possibly damaging 0.74
R2202:Serpinf2 UTSW 11 75436762 missense probably benign 0.07
R3082:Serpinf2 UTSW 11 75437528 missense probably benign 0.19
R5117:Serpinf2 UTSW 11 75432500 missense probably benign 0.28
R5487:Serpinf2 UTSW 11 75433205 missense probably damaging 0.99
R5681:Serpinf2 UTSW 11 75435939 missense probably damaging 0.99
R5764:Serpinf2 UTSW 11 75437404 missense possibly damaging 0.94
R5868:Serpinf2 UTSW 11 75433239 missense probably benign 0.00
R6364:Serpinf2 UTSW 11 75436489 missense probably damaging 1.00
R6488:Serpinf2 UTSW 11 75437503 missense probably benign
R6701:Serpinf2 UTSW 11 75432443 missense probably damaging 0.97
R7034:Serpinf2 UTSW 11 75438418 unclassified probably benign
R7036:Serpinf2 UTSW 11 75438418 unclassified probably benign
YA93:Serpinf2 UTSW 11 75432684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGAAGATTCCCCATGCCTGC -3'
(R):5'- TTCTTCATCATGGAGGACACC -3'

Sequencing Primer
(F):5'- ATGCCTGCCTTCCTCCAG -3'
(R):5'- AGGACACCATAGGCGTGC -3'
Posted On2018-04-27