Incidental Mutation 'R6349:Osmr'
ID512466
Institutional Source Beutler Lab
Gene Symbol Osmr
Ensembl Gene ENSMUSG00000022146
Gene Nameoncostatin M receptor
SynonymsOSMRB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6813577-6874969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6821063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 686 (D686E)
Ref Sequence ENSEMBL: ENSMUSP00000135204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022746] [ENSMUST00000176826]
Predicted Effect probably benign
Transcript: ENSMUST00000022746
AA Change: D687E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000022746
Gene: ENSMUSG00000022146
AA Change: D687E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 607 7.02e1 SMART
FN3 619 720 3.17e-4 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176554
Predicted Effect probably benign
Transcript: ENSMUST00000176826
AA Change: D686E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135204
Gene: ENSMUSG00000022146
AA Change: D686E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
Blast:FN3 234 317 9e-38 BLAST
FN3 330 412 6.25e-3 SMART
FN3 427 512 2.75e0 SMART
FN3 523 606 2.77e1 SMART
FN3 618 719 3.17e-4 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 775 786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein heterodimerizes with interleukin 6 signal transducer to form the type II oncostatin M receptor and with interleukin 31 receptor A to form the interleukin 31 receptor, and thus transduces oncostatin M and interleukin 31 induced signaling events. Mutations in this gene have been associated with familial primary localized cutaneous amyloidosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit anemia, decreased hematocrit, and reduced erythroid progenitor, erythrocyte, platelet, and megakaryocyte cells. Homozygotes also show increased susceptibility to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fech G T 18: 64,470,785 Y164* probably null Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Osmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Osmr APN 15 6844445 nonsense probably null
IGL00335:Osmr APN 15 6837023 missense probably benign 0.00
IGL00497:Osmr APN 15 6847066 missense probably benign 0.26
IGL00510:Osmr APN 15 6823631 nonsense probably null
IGL00811:Osmr APN 15 6815666 missense probably benign 0.28
IGL00959:Osmr APN 15 6824605 missense probably benign 0.12
IGL01115:Osmr APN 15 6847201 splice site probably benign
IGL01307:Osmr APN 15 6844427 missense probably damaging 1.00
IGL01330:Osmr APN 15 6842028 missense probably damaging 1.00
IGL01633:Osmr APN 15 6824604 missense probably damaging 1.00
IGL01780:Osmr APN 15 6828663 missense probably benign 0.00
IGL02164:Osmr APN 15 6842048 missense probably damaging 0.99
IGL02207:Osmr APN 15 6847147 missense probably benign 0.07
IGL02338:Osmr APN 15 6837729 nonsense probably null
IGL02350:Osmr APN 15 6828663 missense probably benign 0.00
IGL02357:Osmr APN 15 6828663 missense probably benign 0.00
IGL02545:Osmr APN 15 6823579 missense probably damaging 0.98
IGL02619:Osmr APN 15 6841994 missense probably damaging 1.00
IGL02685:Osmr APN 15 6815573 missense probably benign 0.00
IGL02959:Osmr APN 15 6815897 missense possibly damaging 0.93
IGL03303:Osmr APN 15 6842808 missense probably benign 0.03
FR4548:Osmr UTSW 15 6837703 small insertion probably benign
FR4737:Osmr UTSW 15 6837706 nonsense probably null
R0149:Osmr UTSW 15 6841951 critical splice donor site probably null
R0361:Osmr UTSW 15 6841951 critical splice donor site probably null
R0492:Osmr UTSW 15 6824518 missense probably damaging 1.00
R0538:Osmr UTSW 15 6841938 splice site probably benign
R0585:Osmr UTSW 15 6837793 missense probably benign
R0980:Osmr UTSW 15 6852440 missense probably benign 0.00
R1221:Osmr UTSW 15 6823561 nonsense probably null
R1922:Osmr UTSW 15 6844367 missense possibly damaging 0.67
R2067:Osmr UTSW 15 6815415 missense probably benign 0.00
R2136:Osmr UTSW 15 6852462 missense probably damaging 1.00
R2156:Osmr UTSW 15 6844410 missense probably benign 0.04
R3683:Osmr UTSW 15 6837053 missense possibly damaging 0.95
R3735:Osmr UTSW 15 6822080 missense probably damaging 1.00
R3736:Osmr UTSW 15 6822080 missense probably damaging 1.00
R4011:Osmr UTSW 15 6824533 missense probably benign 0.01
R4175:Osmr UTSW 15 6852546 missense probably damaging 1.00
R4555:Osmr UTSW 15 6815720 missense possibly damaging 0.73
R4581:Osmr UTSW 15 6842894 missense probably benign 0.00
R4751:Osmr UTSW 15 6842852 missense probably damaging 1.00
R4758:Osmr UTSW 15 6852555 missense probably benign 0.23
R4986:Osmr UTSW 15 6816580 critical splice donor site probably null
R4997:Osmr UTSW 15 6815639 missense probably benign 0.25
R5077:Osmr UTSW 15 6844393 nonsense probably null
R5093:Osmr UTSW 15 6821079 missense probably damaging 0.96
R5120:Osmr UTSW 15 6827275 missense probably benign 0.16
R5331:Osmr UTSW 15 6842881 missense probably damaging 1.00
R5812:Osmr UTSW 15 6837059 missense probably damaging 0.99
R5819:Osmr UTSW 15 6815787 missense probably benign 0.00
R5876:Osmr UTSW 15 6821047 missense probably benign 0.07
R5986:Osmr UTSW 15 6844453 missense probably benign 0.36
R6018:Osmr UTSW 15 6815795 missense probably damaging 1.00
R6164:Osmr UTSW 15 6860352 missense probably benign 0.00
R6217:Osmr UTSW 15 6823566 missense probably damaging 1.00
R6312:Osmr UTSW 15 6823638 missense probably damaging 1.00
R6898:Osmr UTSW 15 6815883 missense probably damaging 0.97
R7139:Osmr UTSW 15 6821088 missense possibly damaging 0.79
R7412:Osmr UTSW 15 6823567 missense probably damaging 1.00
R7527:Osmr UTSW 15 6827122 missense probably damaging 1.00
R7630:Osmr UTSW 15 6816971 missense possibly damaging 0.53
R7730:Osmr UTSW 15 6824482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATCATTTGCTTTGGAGAAAC -3'
(R):5'- AAAGGTCTCTGCCACGTTC -3'

Sequencing Primer
(F):5'- TTGCTTTGGAGAAACTCACAGCG -3'
(R):5'- GATGACCTTGAGCACATTGC -3'
Posted On2018-04-27