Incidental Mutation 'R6349:Fech'
ID512475
Institutional Source Beutler Lab
Gene Symbol Fech
Ensembl Gene ENSMUSG00000024588
Gene Nameferrochelatase
Synonymsfch, Fcl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6349 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location64456550-64489066 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 64470785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 164 (Y164*)
Ref Sequence ENSEMBL: ENSMUSP00000025484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025484]
Predicted Effect probably null
Transcript: ENSMUST00000025484
AA Change: Y164*
SMART Domains Protein: ENSMUSP00000025484
Gene: ENSMUSG00000024588
AA Change: Y164*

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:Ferrochelatase 67 388 5.9e-115 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized to the mitochondrion, where it catalyzes the insertion of the ferrous form of iron into protoporphyrin IX in the heme synthesis pathway. Mutations in this gene are associated with erythropoietic protoporphyria. Two transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome 3.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced mutation exhibit hemolytic anemia, photosensitivity, cholestasis, and hepatic dysfunction. Homozygotes for a targeted null mutation die prior to embryonic day 3.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012A03Rik A G 6: 32,051,660 Y9C probably benign Het
4930433I11Rik A C 7: 40,994,772 M622L possibly damaging Het
Abca8b C T 11: 109,934,718 probably null Het
Adam28 T C 14: 68,633,172 I351V probably benign Het
Adgrd1 A C 5: 129,142,539 probably null Het
Ank3 T A 10: 69,979,439 I473N probably damaging Het
Ankrd6 A T 4: 32,822,231 H179Q probably damaging Het
Ano6 A G 15: 95,966,022 R808G probably damaging Het
Anxa8 A T 14: 34,097,893 I280F probably damaging Het
Asb2 C T 12: 103,345,859 M1I probably null Het
Astn1 C T 1: 158,664,121 Q1023* probably null Het
Cast T A 13: 74,721,195 E542D probably damaging Het
Ccdc162 C T 10: 41,694,400 E30K probably damaging Het
Ccdc87 T C 19: 4,841,319 V613A probably damaging Het
Cdk13 T C 13: 17,751,719 N832S probably damaging Het
Celsr1 T A 15: 86,031,684 N696I probably damaging Het
Chd3 T C 11: 69,364,031 E161G possibly damaging Het
Cxcr4 C A 1: 128,589,277 V216F possibly damaging Het
Cyp4a10 A G 4: 115,525,358 I282V probably benign Het
Deaf1 T C 7: 141,322,950 T154A possibly damaging Het
Dido1 A T 2: 180,660,701 D1803E probably benign Het
Dmxl2 T C 9: 54,419,909 D944G possibly damaging Het
Dnah5 G A 15: 28,238,511 V400M probably damaging Het
Fbxo15 A G 18: 84,964,142 I240V probably benign Het
Fcrls A G 3: 87,252,496 C484R probably damaging Het
Fer1l5 T A 1: 36,411,274 W1175R probably damaging Het
Fgfrl1 T C 5: 108,705,506 Y241H probably damaging Het
Flvcr2 T C 12: 85,747,200 Y117H probably benign Het
Fsip2 T A 2: 82,993,072 M6383K probably benign Het
Gcc2 T A 10: 58,269,474 D141E probably benign Het
Glt1d1 A C 5: 127,706,886 R301S probably benign Het
Hars G C 18: 36,783,054 A16G probably benign Het
Hmcn2 G T 2: 31,388,373 G1696C probably damaging Het
Hydin T A 8: 110,418,459 L814* probably null Het
Izumo4 T A 10: 80,702,717 M1K probably null Het
Kdm5d T A Y: 916,847 M414K probably damaging Homo
Kif21b G A 1: 136,158,326 V812I probably damaging Het
Map3k7 A G 4: 31,988,661 D270G possibly damaging Het
Mical3 A G 6: 120,959,525 S1347P probably benign Het
Mras T A 9: 99,394,616 D67V probably damaging Het
Mtnr1b A T 9: 15,863,213 Y183* probably null Het
Muc16 A T 9: 18,657,329 L1298Q unknown Het
Myh2 A T 11: 67,193,003 I1536F probably benign Het
Olfr371 T C 8: 85,231,158 I221T possibly damaging Het
Osmr G T 15: 6,821,063 D686E probably benign Het
Pah T A 10: 87,578,969 D394E probably benign Het
Pla1a T A 16: 38,417,124 S71C probably benign Het
Proc T A 18: 32,133,433 I114L probably benign Het
Psd T G 19: 46,313,387 probably null Het
Psmb6 C T 11: 70,527,538 Q226* probably null Het
Rnpepl1 A T 1: 92,919,841 N717Y probably damaging Het
Rundc1 T C 11: 101,434,162 S565P probably benign Het
Serpinb5 T A 1: 106,881,765 S300R probably benign Het
Serpinf2 T C 11: 75,432,431 D483G probably damaging Het
Sgsm3 T C 15: 81,008,346 I291T probably benign Het
Smg6 T A 11: 75,053,774 D116E possibly damaging Het
Srfbp1 G T 18: 52,488,962 S365I probably benign Het
Stkld1 A G 2: 26,945,860 T236A probably benign Het
Susd5 T C 9: 114,095,802 V251A probably benign Het
Tcf25 A G 8: 123,391,593 Y314C probably damaging Het
Tmem210 A G 2: 25,289,036 D112G possibly damaging Het
Tubb2b A G 13: 34,127,545 Y422H probably damaging Het
Tyw1 T C 5: 130,277,031 S332P possibly damaging Het
Vmn1r29 A C 6: 58,307,427 Q44P probably damaging Het
Vrtn T C 12: 84,649,018 S181P probably damaging Het
Wdr76 T A 2: 121,534,231 Y437N possibly damaging Het
Zc3h18 C A 8: 122,408,286 probably benign Het
Zfp287 G T 11: 62,725,342 D174E probably damaging Het
Zfp800 A T 6: 28,244,602 Y121* probably null Het
Zfyve19 T A 2: 119,210,597 L57Q probably damaging Het
Other mutations in Fech
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0652:Fech UTSW 18 64458169 missense probably damaging 1.00
R1468:Fech UTSW 18 64470673 splice site probably benign
R1619:Fech UTSW 18 64462118 missense probably damaging 1.00
R1652:Fech UTSW 18 64458198 missense probably benign
R2020:Fech UTSW 18 64478727 missense probably damaging 0.99
R2082:Fech UTSW 18 64458189 missense probably damaging 0.99
R5334:Fech UTSW 18 64464120 missense probably damaging 1.00
R5930:Fech UTSW 18 64478649 critical splice donor site probably null
R6365:Fech UTSW 18 64458180 missense probably benign 0.00
R7412:Fech UTSW 18 64458184 missense probably benign 0.00
R7492:Fech UTSW 18 64467771 nonsense probably null
R7539:Fech UTSW 18 64483494 intron probably null
R7545:Fech UTSW 18 64464114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCACTCAGACTCCTGG -3'
(R):5'- TGATCTCAGAGATTGACCAAGCG -3'

Sequencing Primer
(F):5'- TCAGACTCCTGGGCTAACC -3'
(R):5'- CATGCCTGCTAAGTGATGGAC -3'
Posted On2018-04-27