Incidental Mutation 'R6362:Rusc2'
ID 512497
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene Name RUN and SH3 domain containing 2
Synonyms
MMRRC Submission 044512-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R6362 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43381979-43427088 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 43416416 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 574 (D574V)
Ref Sequence ENSEMBL: ENSMUSP00000095710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000098106] [ENSMUST00000125399] [ENSMUST00000131668] [ENSMUST00000152322] [ENSMUST00000149221] [ENSMUST00000135216] [ENSMUST00000139198] [ENSMUST00000136360] [ENSMUST00000144911] [ENSMUST00000173682]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035645
AA Change: D574V

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: D574V

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098106
AA Change: D574V

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: D574V

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect probably benign
Transcript: ENSMUST00000125399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131037
Predicted Effect probably benign
Transcript: ENSMUST00000131668
AA Change: D574V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: D574V

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152322
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000135216
Predicted Effect probably benign
Transcript: ENSMUST00000139198
SMART Domains Protein: ENSMUSP00000121528
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136360
SMART Domains Protein: ENSMUSP00000123431
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144911
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh5a1 T G 13: 25,102,533 (GRCm39) D310A probably benign Het
Als2cl T A 9: 110,724,514 (GRCm39) probably null Het
Amacr C A 15: 10,984,891 (GRCm39) R170S probably damaging Het
Brwd1 C T 16: 95,803,507 (GRCm39) R2221Q probably damaging Het
Cacna1g A T 11: 94,330,533 (GRCm39) probably null Het
Cd3d G A 9: 44,897,589 (GRCm39) D157N probably damaging Het
Cep131 T C 11: 119,955,516 (GRCm39) D1043G probably damaging Het
Cimip1 T G 2: 173,369,967 (GRCm39) probably null Het
Cit A G 5: 116,024,735 (GRCm39) D326G probably benign Het
Col16a1 G C 4: 129,959,983 (GRCm39) G370R unknown Het
Col6a3 T A 1: 90,738,285 (GRCm39) Y1078F probably damaging Het
Colgalt2 A C 1: 152,347,549 (GRCm39) Y161S probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Daxx G A 17: 34,130,338 (GRCm39) V118I probably damaging Het
Dennd5a G T 7: 109,533,472 (GRCm39) C75* probably null Het
Diaph3 A G 14: 87,009,566 (GRCm39) L1071P probably damaging Het
Disp3 A G 4: 148,338,765 (GRCm39) L802P possibly damaging Het
Dmc1 A G 15: 79,473,024 (GRCm39) V141A probably benign Het
Dsc2 A T 18: 20,168,520 (GRCm39) Y45* probably null Het
Dspp A G 5: 104,323,900 (GRCm39) I348V probably benign Het
Epb42 C A 2: 120,856,260 (GRCm39) C428F possibly damaging Het
Fam227a G T 15: 79,527,551 (GRCm39) P100Q possibly damaging Het
Fer1l4 C T 2: 155,890,170 (GRCm39) V252I probably benign Het
Fhod1 C A 8: 106,058,273 (GRCm39) probably null Het
Fhod3 G T 18: 24,887,312 (GRCm39) A68S probably benign Het
Gatm T C 2: 122,428,677 (GRCm39) D328G probably benign Het
Gm6401 G T 14: 41,789,727 (GRCm39) H44N probably benign Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gpr84 G A 15: 103,216,937 (GRCm39) A380V probably damaging Het
Herc1 G T 9: 66,379,190 (GRCm39) W3492L probably damaging Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Jag2 T A 12: 112,883,742 (GRCm39) K246N probably damaging Het
Klhl32 T C 4: 24,629,195 (GRCm39) D524G probably null Het
Lax1 A G 1: 133,608,334 (GRCm39) S136P possibly damaging Het
Lefty1 A G 1: 180,764,725 (GRCm39) K217E probably benign Het
Lgr5 A G 10: 115,314,430 (GRCm39) L169P probably damaging Het
Lrrc37 G C 11: 103,511,478 (GRCm39) N163K unknown Het
Mad1l1 A T 5: 140,300,810 (GRCm39) S29T possibly damaging Het
Man1a T C 10: 53,950,891 (GRCm39) H77R probably benign Het
Met C T 6: 17,558,732 (GRCm39) S1120F probably damaging Het
Mfsd4b2 A T 10: 39,797,605 (GRCm39) I250N probably damaging Het
Myod1 A G 7: 46,026,305 (GRCm39) H70R possibly damaging Het
Neb T C 2: 52,102,704 (GRCm39) N4280S probably benign Het
Nudt6 T C 3: 37,473,638 (GRCm39) T28A possibly damaging Het
Nup85 A G 11: 115,474,560 (GRCm39) E628G probably damaging Het
Oaz3 A T 3: 94,342,295 (GRCm39) D120E probably damaging Het
Or2y3 A T 17: 38,393,620 (GRCm39) M83K probably damaging Het
Or5b102 A T 19: 13,040,709 (GRCm39) probably benign Het
Or5be3 C T 2: 86,863,633 (GRCm39) A311T probably benign Het
Or5m8 C A 2: 85,822,285 (GRCm39) N41K probably damaging Het
Or6c1b A C 10: 129,272,812 (GRCm39) I44L probably damaging Het
Osbpl8 A T 10: 111,108,929 (GRCm39) K404* probably null Het
Pcdhga2 A G 18: 37,803,958 (GRCm39) N601D probably damaging Het
Pld2 T C 11: 70,445,501 (GRCm39) Y638H probably damaging Het
Pramel27 A G 4: 143,579,435 (GRCm39) Y340C probably damaging Het
Prickle2 C G 6: 92,435,596 (GRCm39) V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 (GRCm38) R125C probably benign Het
Rnaset2b G A 17: 7,259,093 (GRCm39) V24I probably benign Het
Scn8a T A 15: 100,837,996 (GRCm39) probably null Het
Sec11a T C 7: 80,572,879 (GRCm39) E134G probably benign Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Shkbp1 C T 7: 27,051,120 (GRCm39) probably null Het
Slc43a1 T C 2: 84,690,128 (GRCm39) L435P probably damaging Het
Spn G A 7: 126,735,895 (GRCm39) P204L possibly damaging Het
Srr T A 11: 74,801,028 (GRCm39) Q173L probably damaging Het
Star C G 8: 26,301,835 (GRCm39) T222S probably benign Het
Timm22 T A 11: 76,301,953 (GRCm39) Y93N probably damaging Het
Tmc4 G T 7: 3,678,458 (GRCm39) Q58K probably benign Het
Tmem86b C T 7: 4,632,835 (GRCm39) M1I probably null Het
Tmtc2 A T 10: 105,205,831 (GRCm39) I488N probably damaging Het
Tnxb A T 17: 34,913,362 (GRCm39) Y1792F probably damaging Het
Tph1 T A 7: 46,296,867 (GRCm39) R443W possibly damaging Het
Ttyh1 T A 7: 4,132,323 (GRCm39) V253E possibly damaging Het
Usf3 A G 16: 44,038,940 (GRCm39) D1140G probably benign Het
Usp10 T C 8: 120,668,055 (GRCm39) S118P probably benign Het
Vmn2r63 C T 7: 42,552,721 (GRCm39) C845Y probably benign Het
Vmn2r72 G T 7: 85,400,382 (GRCm39) F222L probably damaging Het
Zfp654 G A 16: 64,606,457 (GRCm39) Q582* probably null Het
Zfp791 C T 8: 85,846,279 (GRCm39) probably benign Het
Zfp879 T A 11: 50,729,302 (GRCm39) D32V probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43,426,116 (GRCm39) missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43,416,434 (GRCm39) missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43,415,840 (GRCm39) missense probably benign 0.08
IGL01628:Rusc2 APN 4 43,425,729 (GRCm39) missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43,415,738 (GRCm39) missense probably benign 0.02
IGL02030:Rusc2 APN 4 43,416,095 (GRCm39) missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43,425,668 (GRCm39) missense probably benign
IGL02115:Rusc2 APN 4 43,426,136 (GRCm39) splice site probably benign
IGL02122:Rusc2 APN 4 43,421,685 (GRCm39) missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43,415,545 (GRCm39) missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43,416,376 (GRCm39) missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43,425,806 (GRCm39) missense probably benign 0.00
P0026:Rusc2 UTSW 4 43,415,840 (GRCm39) missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43,424,009 (GRCm39) missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0114:Rusc2 UTSW 4 43,422,055 (GRCm39) missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43,423,954 (GRCm39) missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43,425,486 (GRCm39) missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43,416,137 (GRCm39) missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43,416,568 (GRCm39) missense probably benign 0.00
R1416:Rusc2 UTSW 4 43,421,617 (GRCm39) missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43,426,046 (GRCm39) missense probably benign
R1864:Rusc2 UTSW 4 43,421,719 (GRCm39) missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43,421,749 (GRCm39) missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43,415,212 (GRCm39) missense probably benign 0.06
R2212:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43,416,260 (GRCm39) missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R2886:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R3412:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43,416,424 (GRCm39) missense probably benign 0.45
R4135:Rusc2 UTSW 4 43,425,563 (GRCm39) missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43,415,533 (GRCm39) missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43,416,080 (GRCm39) missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43,423,942 (GRCm39) missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43,415,926 (GRCm39) missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43,415,240 (GRCm39) missense probably benign 0.05
R5131:Rusc2 UTSW 4 43,414,948 (GRCm39) missense probably benign 0.03
R5177:Rusc2 UTSW 4 43,421,805 (GRCm39) splice site probably null
R5540:Rusc2 UTSW 4 43,423,975 (GRCm39) missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43,415,932 (GRCm39) nonsense probably null
R5628:Rusc2 UTSW 4 43,425,348 (GRCm39) missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43,425,758 (GRCm39) missense probably benign 0.06
R6129:Rusc2 UTSW 4 43,424,271 (GRCm39) missense probably damaging 1.00
R6633:Rusc2 UTSW 4 43,414,852 (GRCm39) missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R7491:Rusc2 UTSW 4 43,426,528 (GRCm39) missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43,425,335 (GRCm39) missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43,414,900 (GRCm39) nonsense probably null
R7710:Rusc2 UTSW 4 43,416,119 (GRCm39) missense probably benign 0.07
R8052:Rusc2 UTSW 4 43,421,851 (GRCm39) missense probably benign
R8061:Rusc2 UTSW 4 43,422,492 (GRCm39) missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43,423,747 (GRCm39) missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43,425,378 (GRCm39) missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8397:Rusc2 UTSW 4 43,424,206 (GRCm39) missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8553:Rusc2 UTSW 4 43,416,508 (GRCm39) missense probably benign 0.05
R8725:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8725:Rusc2 UTSW 4 43,415,396 (GRCm39) missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8834:Rusc2 UTSW 4 43,416,431 (GRCm39) missense possibly damaging 0.94
R9295:Rusc2 UTSW 4 43,416,382 (GRCm39) missense probably damaging 0.98
R9483:Rusc2 UTSW 4 43,415,897 (GRCm39) missense probably damaging 0.97
R9666:Rusc2 UTSW 4 43,416,262 (GRCm39) missense probably benign 0.21
R9705:Rusc2 UTSW 4 43,424,936 (GRCm39) missense probably benign 0.00
X0025:Rusc2 UTSW 4 43,422,226 (GRCm39) missense probably benign 0.00
X0066:Rusc2 UTSW 4 43,422,204 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGAAGCTATGACCGTAGC -3'
(R):5'- TAGGAAGTGGCATCTCGCTG -3'

Sequencing Primer
(F):5'- AGCTATGACCGTAGCCTGGAG -3'
(R):5'- AAGTGGCATCTCGCTGGACTG -3'
Posted On 2018-04-27