Incidental Mutation 'R6362:Disp3'
ID 512501
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Name dispatched RND transporter family member 3
Synonyms G630052C06Rik, Ptchd2
MMRRC Submission 044512-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6362 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 148324721-148372422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 148338765 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 802 (L802P)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: L802P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: L802P

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143851
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh5a1 T G 13: 25,102,533 (GRCm39) D310A probably benign Het
Als2cl T A 9: 110,724,514 (GRCm39) probably null Het
Amacr C A 15: 10,984,891 (GRCm39) R170S probably damaging Het
Brwd1 C T 16: 95,803,507 (GRCm39) R2221Q probably damaging Het
Cacna1g A T 11: 94,330,533 (GRCm39) probably null Het
Cd3d G A 9: 44,897,589 (GRCm39) D157N probably damaging Het
Cep131 T C 11: 119,955,516 (GRCm39) D1043G probably damaging Het
Cimip1 T G 2: 173,369,967 (GRCm39) probably null Het
Cit A G 5: 116,024,735 (GRCm39) D326G probably benign Het
Col16a1 G C 4: 129,959,983 (GRCm39) G370R unknown Het
Col6a3 T A 1: 90,738,285 (GRCm39) Y1078F probably damaging Het
Colgalt2 A C 1: 152,347,549 (GRCm39) Y161S probably damaging Het
Cyp2j13 A G 4: 95,959,932 (GRCm39) Y75H probably damaging Het
Daxx G A 17: 34,130,338 (GRCm39) V118I probably damaging Het
Dennd5a G T 7: 109,533,472 (GRCm39) C75* probably null Het
Diaph3 A G 14: 87,009,566 (GRCm39) L1071P probably damaging Het
Dmc1 A G 15: 79,473,024 (GRCm39) V141A probably benign Het
Dsc2 A T 18: 20,168,520 (GRCm39) Y45* probably null Het
Dspp A G 5: 104,323,900 (GRCm39) I348V probably benign Het
Epb42 C A 2: 120,856,260 (GRCm39) C428F possibly damaging Het
Fam227a G T 15: 79,527,551 (GRCm39) P100Q possibly damaging Het
Fer1l4 C T 2: 155,890,170 (GRCm39) V252I probably benign Het
Fhod1 C A 8: 106,058,273 (GRCm39) probably null Het
Fhod3 G T 18: 24,887,312 (GRCm39) A68S probably benign Het
Gatm T C 2: 122,428,677 (GRCm39) D328G probably benign Het
Gm6401 G T 14: 41,789,727 (GRCm39) H44N probably benign Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gpr84 G A 15: 103,216,937 (GRCm39) A380V probably damaging Het
Herc1 G T 9: 66,379,190 (GRCm39) W3492L probably damaging Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Jag2 T A 12: 112,883,742 (GRCm39) K246N probably damaging Het
Klhl32 T C 4: 24,629,195 (GRCm39) D524G probably null Het
Lax1 A G 1: 133,608,334 (GRCm39) S136P possibly damaging Het
Lefty1 A G 1: 180,764,725 (GRCm39) K217E probably benign Het
Lgr5 A G 10: 115,314,430 (GRCm39) L169P probably damaging Het
Lrrc37 G C 11: 103,511,478 (GRCm39) N163K unknown Het
Mad1l1 A T 5: 140,300,810 (GRCm39) S29T possibly damaging Het
Man1a T C 10: 53,950,891 (GRCm39) H77R probably benign Het
Met C T 6: 17,558,732 (GRCm39) S1120F probably damaging Het
Mfsd4b2 A T 10: 39,797,605 (GRCm39) I250N probably damaging Het
Myod1 A G 7: 46,026,305 (GRCm39) H70R possibly damaging Het
Neb T C 2: 52,102,704 (GRCm39) N4280S probably benign Het
Nudt6 T C 3: 37,473,638 (GRCm39) T28A possibly damaging Het
Nup85 A G 11: 115,474,560 (GRCm39) E628G probably damaging Het
Oaz3 A T 3: 94,342,295 (GRCm39) D120E probably damaging Het
Or2y3 A T 17: 38,393,620 (GRCm39) M83K probably damaging Het
Or5b102 A T 19: 13,040,709 (GRCm39) probably benign Het
Or5be3 C T 2: 86,863,633 (GRCm39) A311T probably benign Het
Or5m8 C A 2: 85,822,285 (GRCm39) N41K probably damaging Het
Or6c1b A C 10: 129,272,812 (GRCm39) I44L probably damaging Het
Osbpl8 A T 10: 111,108,929 (GRCm39) K404* probably null Het
Pcdhga2 A G 18: 37,803,958 (GRCm39) N601D probably damaging Het
Pld2 T C 11: 70,445,501 (GRCm39) Y638H probably damaging Het
Pramel27 A G 4: 143,579,435 (GRCm39) Y340C probably damaging Het
Prickle2 C G 6: 92,435,596 (GRCm39) V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 (GRCm38) R125C probably benign Het
Rnaset2b G A 17: 7,259,093 (GRCm39) V24I probably benign Het
Rusc2 A T 4: 43,416,416 (GRCm39) D574V probably benign Het
Scn8a T A 15: 100,837,996 (GRCm39) probably null Het
Sec11a T C 7: 80,572,879 (GRCm39) E134G probably benign Het
Senp5 A G 16: 31,808,702 (GRCm39) V157A probably damaging Het
Shkbp1 C T 7: 27,051,120 (GRCm39) probably null Het
Slc43a1 T C 2: 84,690,128 (GRCm39) L435P probably damaging Het
Spn G A 7: 126,735,895 (GRCm39) P204L possibly damaging Het
Srr T A 11: 74,801,028 (GRCm39) Q173L probably damaging Het
Star C G 8: 26,301,835 (GRCm39) T222S probably benign Het
Timm22 T A 11: 76,301,953 (GRCm39) Y93N probably damaging Het
Tmc4 G T 7: 3,678,458 (GRCm39) Q58K probably benign Het
Tmem86b C T 7: 4,632,835 (GRCm39) M1I probably null Het
Tmtc2 A T 10: 105,205,831 (GRCm39) I488N probably damaging Het
Tnxb A T 17: 34,913,362 (GRCm39) Y1792F probably damaging Het
Tph1 T A 7: 46,296,867 (GRCm39) R443W possibly damaging Het
Ttyh1 T A 7: 4,132,323 (GRCm39) V253E possibly damaging Het
Usf3 A G 16: 44,038,940 (GRCm39) D1140G probably benign Het
Usp10 T C 8: 120,668,055 (GRCm39) S118P probably benign Het
Vmn2r63 C T 7: 42,552,721 (GRCm39) C845Y probably benign Het
Vmn2r72 G T 7: 85,400,382 (GRCm39) F222L probably damaging Het
Zfp654 G A 16: 64,606,457 (GRCm39) Q582* probably null Het
Zfp791 C T 8: 85,846,279 (GRCm39) probably benign Het
Zfp879 T A 11: 50,729,302 (GRCm39) D32V probably damaging Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148,325,991 (GRCm39) missense probably benign 0.10
IGL01065:Disp3 APN 4 148,345,640 (GRCm39) missense probably damaging 1.00
IGL01800:Disp3 APN 4 148,334,258 (GRCm39) nonsense probably null
IGL01947:Disp3 APN 4 148,344,976 (GRCm39) missense probably damaging 1.00
IGL02510:Disp3 APN 4 148,337,158 (GRCm39) missense probably benign 0.00
IGL02573:Disp3 APN 4 148,355,906 (GRCm39) missense probably damaging 1.00
IGL02728:Disp3 APN 4 148,356,495 (GRCm39) missense probably damaging 1.00
IGL02931:Disp3 APN 4 148,333,658 (GRCm39) missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0257:Disp3 UTSW 4 148,335,211 (GRCm39) missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148,356,416 (GRCm39) missense probably damaging 1.00
R0557:Disp3 UTSW 4 148,325,861 (GRCm39) missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148,326,047 (GRCm39) missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148,334,282 (GRCm39) missense probably benign 0.00
R1526:Disp3 UTSW 4 148,344,373 (GRCm39) missense probably benign 0.00
R1791:Disp3 UTSW 4 148,325,975 (GRCm39) missense probably damaging 1.00
R1856:Disp3 UTSW 4 148,356,089 (GRCm39) missense probably damaging 1.00
R1987:Disp3 UTSW 4 148,343,210 (GRCm39) missense probably damaging 0.97
R2030:Disp3 UTSW 4 148,344,423 (GRCm39) missense probably damaging 1.00
R2271:Disp3 UTSW 4 148,356,059 (GRCm39) missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148,343,252 (GRCm39) missense probably damaging 1.00
R2566:Disp3 UTSW 4 148,325,880 (GRCm39) missense probably damaging 1.00
R3731:Disp3 UTSW 4 148,337,284 (GRCm39) missense probably benign 0.03
R4359:Disp3 UTSW 4 148,356,389 (GRCm39) missense probably benign 0.03
R4762:Disp3 UTSW 4 148,356,575 (GRCm39) missense probably damaging 1.00
R4950:Disp3 UTSW 4 148,342,583 (GRCm39) missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148,328,673 (GRCm39) missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148,327,333 (GRCm39) missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148,342,554 (GRCm39) missense probably benign 0.14
R5556:Disp3 UTSW 4 148,342,614 (GRCm39) missense probably benign 0.14
R5857:Disp3 UTSW 4 148,333,640 (GRCm39) missense probably benign 0.01
R5933:Disp3 UTSW 4 148,325,770 (GRCm39) nonsense probably null
R5994:Disp3 UTSW 4 148,338,741 (GRCm39) missense possibly damaging 0.94
R6813:Disp3 UTSW 4 148,344,387 (GRCm39) missense probably benign 0.09
R7211:Disp3 UTSW 4 148,325,979 (GRCm39) missense probably damaging 0.98
R7470:Disp3 UTSW 4 148,345,527 (GRCm39) missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148,327,323 (GRCm39) missense probably damaging 0.99
R8093:Disp3 UTSW 4 148,354,973 (GRCm39) missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8457:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148,326,027 (GRCm39) missense possibly damaging 0.77
R9182:Disp3 UTSW 4 148,354,841 (GRCm39) missense probably damaging 1.00
R9219:Disp3 UTSW 4 148,334,317 (GRCm39) missense possibly damaging 0.74
R9680:Disp3 UTSW 4 148,356,101 (GRCm39) missense probably damaging 1.00
R9696:Disp3 UTSW 4 148,345,611 (GRCm39) missense probably damaging 0.97
Z1088:Disp3 UTSW 4 148,356,200 (GRCm39) missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148,335,414 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,335,171 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,334,304 (GRCm39) missense probably benign 0.01
Z1177:Disp3 UTSW 4 148,334,203 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,355,024 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGCAGACCCTCATGTG -3'
(R):5'- ACAACACCTGGGGATAAGCC -3'

Sequencing Primer
(F):5'- TCATGTGCCAGGAACAGCTC -3'
(R):5'- CACCTGGGGATAAGCCTGAGAC -3'
Posted On 2018-04-27