Mutagenetix > Incidental Mutations

Incidental Mutation 'R6362:Dspp'

512502

Institutional Source

Beutler Lab

Gene Symbol

Dspp

Ensembl Gene

ENSMUSG00000053268

Gene Name

dentin sialophosphoprotein

Synonyms

Dmp3, Dsp, Dpp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6362 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104170712-104180127 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104176034 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 348 (I348V)

Ref Sequence

ENSEMBL: ENSMUSP00000108391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112771]

Predicted Effect

probably benign
Transcript: ENSMUST00000112771
AA Change: I348V

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: I348V

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	52	67	N/A	INTRINSIC
internal_repeat_1	82	245	2.01e-11	PROSPERO
low complexity region	247	268	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
internal_repeat_1	285	438	2.01e-11	PROSPERO
internal_repeat_2	286	369	2.15e-10	PROSPERO
internal_repeat_2	370	454	2.15e-10	PROSPERO
low complexity region	456	472	N/A	INTRINSIC
low complexity region	481	944	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F07Rik	T	G	2: 173,528,174		probably null	Het
Aldh5a1	T	G	13: 24,918,550	D310A	probably benign	Het
Als2cl	T	A	9: 110,895,446		probably null	Het
Amacr	C	A	15: 10,984,805	R170S	probably damaging	Het
Brwd1	C	T	16: 96,002,307	R2221Q	probably damaging	Het
Cacna1g	A	T	11: 94,439,707		probably null	Het
Cd3d	G	A	9: 44,986,291	D157N	probably damaging	Het
Cep131	T	C	11: 120,064,690	D1043G	probably damaging	Het
Cit	A	G	5: 115,886,676	D326G	probably benign	Het
Col16a1	G	C	4: 130,066,190	G370R	unknown	Het
Col6a3	T	A	1: 90,810,563	Y1078F	probably damaging	Het
Colgalt2	A	C	1: 152,471,798	Y161S	probably damaging	Het
Cyp2j13	A	G	4: 96,071,695	Y75H	probably damaging	Het
Daxx	G	A	17: 33,911,364	V118I	probably damaging	Het
Dennd5a	G	T	7: 109,934,265	C75*	probably null	Het
Diaph3	A	G	14: 86,772,130	L1071P	probably damaging	Het
Disp3	A	G	4: 148,254,308	L802P	possibly damaging	Het
Dmc1	A	G	15: 79,588,823	V141A	probably benign	Het
Dsc2	A	T	18: 20,035,463	Y45*	probably null	Het
Epb42	C	A	2: 121,025,779	C428F	possibly damaging	Het
Fam227a	G	T	15: 79,643,350	P100Q	possibly damaging	Het
Fer1l4	C	T	2: 156,048,250	V252I	probably benign	Het
Fhod1	C	A	8: 105,331,641		probably null	Het
Fhod3	G	T	18: 24,754,255	A68S	probably benign	Het
Gatm	T	C	2: 122,598,196	D328G	probably benign	Het
Gm13103	A	G	4: 143,852,865	Y340C	probably damaging	Het
Gm6401	G	T	14: 41,967,770	H44N	probably benign	Het
Gm884	G	C	11: 103,620,652	N163K	unknown	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpr84	G	A	15: 103,308,510	A380V	probably damaging	Het
Herc1	G	T	9: 66,471,908	W3492L	probably damaging	Het
Hjurp	A	T	1: 88,275,050	Y71N	possibly damaging	Het
Jag2	T	A	12: 112,920,122	K246N	probably damaging	Het
Klhl32	T	C	4: 24,629,195	D524G	probably null	Het
Lax1	A	G	1: 133,680,596	S136P	possibly damaging	Het
Lefty1	A	G	1: 180,937,160	K217E	probably benign	Het
Lgr5	A	G	10: 115,478,525	L169P	probably damaging	Het
Mad1l1	A	T	5: 140,315,055	S29T	possibly damaging	Het
Man1a	T	C	10: 54,074,795	H77R	probably benign	Het
Met	C	T	6: 17,558,733	S1120F	probably damaging	Het
Mfsd4b2	A	T	10: 39,921,609	I250N	probably damaging	Het
Myod1	A	G	7: 46,376,881	H70R	possibly damaging	Het
Neb	T	C	2: 52,212,692	N4280S	probably benign	Het
Nudt6	T	C	3: 37,419,489	T28A	possibly damaging	Het
Nup85	A	G	11: 115,583,734	E628G	probably damaging	Het
Oaz3	A	T	3: 94,434,988	D120E	probably damaging	Het
Olfr1031	C	A	2: 85,991,941	N41K	probably damaging	Het
Olfr1105	C	T	2: 87,033,289	A311T	probably benign	Het
Olfr131	A	T	17: 38,082,729	M83K	probably damaging	Het
Olfr1454	A	T	19: 13,063,345		probably benign	Het
Olfr786	A	C	10: 129,436,943	I44L	probably damaging	Het
Osbpl8	A	T	10: 111,273,068	K404*	probably null	Het
Pcdhga2	A	G	18: 37,670,905	N601D	probably damaging	Het
Pld2	T	C	11: 70,554,675	Y638H	probably damaging	Het
Prickle2	C	G	6: 92,458,615	V2L	possibly damaging	Het
Psmd6	G	A	14: 14,116,949	R125C	probably benign	Het
Rnaset2b	G	A	17: 6,991,694	V24I	probably benign	Het
Rusc2	A	T	4: 43,416,416	D574V	probably benign	Het
Scn8a	T	A	15: 100,940,115		probably null	Het
Sec11a	T	C	7: 80,923,131	E134G	probably benign	Het
Senp5	A	G	16: 31,989,884	V157A	probably damaging	Het
Shkbp1	C	T	7: 27,351,695		probably null	Het
Slc43a1	T	C	2: 84,859,784	L435P	probably damaging	Het
Spn	G	A	7: 127,136,723	P204L	possibly damaging	Het
Srr	T	A	11: 74,910,202	Q173L	probably damaging	Het
Star	C	G	8: 25,811,807	T222S	probably benign	Het
Timm22	T	A	11: 76,411,127	Y93N	probably damaging	Het
Tmc4	G	T	7: 3,675,459	Q58K	probably benign	Het
Tmem86b	C	T	7: 4,629,836	M1I	probably null	Het
Tmtc2	A	T	10: 105,369,970	I488N	probably damaging	Het
Tnxb	A	T	17: 34,694,388	Y1792F	probably damaging	Het
Tph1	T	A	7: 46,647,443	R443W	possibly damaging	Het
Ttyh1	T	A	7: 4,129,324	V253E	possibly damaging	Het
Usf3	A	G	16: 44,218,577	D1140G	probably benign	Het
Usp10	T	C	8: 119,941,316	S118P	probably benign	Het
Vmn2r63	C	T	7: 42,903,297	C845Y	probably benign	Het
Vmn2r72	G	T	7: 85,751,174	F222L	probably damaging	Het
Zfp654	G	A	16: 64,786,094	Q582*	probably null	Het
Zfp791	C	T	8: 85,119,650		probably benign	Het
Zfp879	T	A	11: 50,838,475	D32V	probably damaging	Het

Other mutations in Dspp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Dspp	APN	5	104176892	missense	possibly damaging	0.95
IGL01096:Dspp	APN	5	104175367	missense	possibly damaging	0.92
IGL01317:Dspp	APN	5	104174048	missense	probably damaging	0.99
IGL02365:Dspp	APN	5	104176061	missense	probably damaging	1.00
IGL02387:Dspp	APN	5	104175624	missense	possibly damaging	0.82
IGL02406:Dspp	APN	5	104177366	nonsense	probably null
IGL02445:Dspp	APN	5	104177097	missense	probably damaging	0.99
IGL02481:Dspp	APN	5	104175648	missense	possibly damaging	0.94
IGL02536:Dspp	APN	5	104175665	missense	probably damaging	0.99
IGL02572:Dspp	APN	5	104177069	missense	probably damaging	0.99
IGL02677:Dspp	APN	5	104175977	missense	possibly damaging	0.78
IGL02709:Dspp	APN	5	104177250	missense	unknown
IGL02723:Dspp	APN	5	104175175	missense	probably benign	0.03
IGL02740:Dspp	APN	5	104177238	nonsense	probably null
IGL03274:Dspp	APN	5	104174948	missense	probably damaging	0.99
IGL03293:Dspp	APN	5	104177561	missense	unknown
FR4449:Dspp	UTSW	5	104178388	small deletion	probably benign
R0018:Dspp	UTSW	5	104178230	missense	unknown
R0125:Dspp	UTSW	5	104178039	missense	unknown
R0503:Dspp	UTSW	5	104177256	missense	unknown
R1709:Dspp	UTSW	5	104175724	missense	probably damaging	0.98
R1851:Dspp	UTSW	5	104174085	critical splice donor site	probably null
R2001:Dspp	UTSW	5	104178559	missense	unknown
R2002:Dspp	UTSW	5	104178559	missense	unknown
R2198:Dspp	UTSW	5	104175701	missense	probably benign	0.37
R2279:Dspp	UTSW	5	104178384	missense	unknown
R4026:Dspp	UTSW	5	104177697	missense	unknown
R4066:Dspp	UTSW	5	104177194	missense	unknown
R4632:Dspp	UTSW	5	104177406	missense	unknown
R4693:Dspp	UTSW	5	104178062	missense	unknown
R4841:Dspp	UTSW	5	104177186	missense	unknown
R4841:Dspp	UTSW	5	104177187	missense	unknown
R4917:Dspp	UTSW	5	104177923	missense	unknown
R5008:Dspp	UTSW	5	104175573	missense	possibly damaging	0.66
R5015:Dspp	UTSW	5	104177060	missense	possibly damaging	0.46
R5214:Dspp	UTSW	5	104178498	missense	unknown
R5359:Dspp	UTSW	5	104175886	missense	probably damaging	0.98
R5538:Dspp	UTSW	5	104175230	nonsense	probably null
R5703:Dspp	UTSW	5	104177051	missense	possibly damaging	0.82
R5887:Dspp	UTSW	5	104175455	missense	probably damaging	1.00
R5902:Dspp	UTSW	5	104178111	missense	unknown
R5992:Dspp	UTSW	5	104178451	missense	unknown
R6019:Dspp	UTSW	5	104178039	missense	unknown
R6191:Dspp	UTSW	5	104177348	missense	unknown
R6736:Dspp	UTSW	5	104178175	missense	unknown
R6805:Dspp	UTSW	5	104175850	missense	probably benign	0.03
R7064:Dspp	UTSW	5	104176938	missense	possibly damaging	0.73
R7178:Dspp	UTSW	5	104174066	missense	probably benign	0.02
R7243:Dspp	UTSW	5	104178361	small deletion	probably benign
R7390:Dspp	UTSW	5	104175686	missense	probably damaging	0.98
R7454:Dspp	UTSW	5	104175610	missense	probably benign	0.01
R7585:Dspp	UTSW	5	104175525	missense	possibly damaging	0.90
R7662:Dspp	UTSW	5	104177870	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGAAGATACAGGCTCTGGTGATG -3'
(R):5'- CTAAAATAGAACCCAGATGCTTAGC -3'

Sequencing Primer
(F):5'- TCTCATGGGGGAAACACTGACC -3'
(R):5'- GCATAGTACTTTTATGCTTGTTTGG -3'

Posted On

2018-04-27