Incidental Mutation 'R6362:Cit'
ID512503
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R6362 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115886676 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 326 (D326G)
Ref Sequence ENSEMBL: ENSMUSP00000115802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably benign
Transcript: ENSMUST00000051704
AA Change: D326G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: D326G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
AA Change: D326G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: D326G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
AA Change: D326G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: D326G

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141101
AA Change: D326G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: D326G

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202734
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T G 2: 173,528,174 probably null Het
Aldh5a1 T G 13: 24,918,550 D310A probably benign Het
Als2cl T A 9: 110,895,446 probably null Het
Amacr C A 15: 10,984,805 R170S probably damaging Het
Brwd1 C T 16: 96,002,307 R2221Q probably damaging Het
Cacna1g A T 11: 94,439,707 probably null Het
Cd3d G A 9: 44,986,291 D157N probably damaging Het
Cep131 T C 11: 120,064,690 D1043G probably damaging Het
Col16a1 G C 4: 130,066,190 G370R unknown Het
Col6a3 T A 1: 90,810,563 Y1078F probably damaging Het
Colgalt2 A C 1: 152,471,798 Y161S probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Daxx G A 17: 33,911,364 V118I probably damaging Het
Dennd5a G T 7: 109,934,265 C75* probably null Het
Diaph3 A G 14: 86,772,130 L1071P probably damaging Het
Disp3 A G 4: 148,254,308 L802P possibly damaging Het
Dmc1 A G 15: 79,588,823 V141A probably benign Het
Dsc2 A T 18: 20,035,463 Y45* probably null Het
Dspp A G 5: 104,176,034 I348V probably benign Het
Epb42 C A 2: 121,025,779 C428F possibly damaging Het
Fam227a G T 15: 79,643,350 P100Q possibly damaging Het
Fer1l4 C T 2: 156,048,250 V252I probably benign Het
Fhod1 C A 8: 105,331,641 probably null Het
Fhod3 G T 18: 24,754,255 A68S probably benign Het
Gatm T C 2: 122,598,196 D328G probably benign Het
Gm13103 A G 4: 143,852,865 Y340C probably damaging Het
Gm6401 G T 14: 41,967,770 H44N probably benign Het
Gm884 G C 11: 103,620,652 N163K unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr84 G A 15: 103,308,510 A380V probably damaging Het
Herc1 G T 9: 66,471,908 W3492L probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Jag2 T A 12: 112,920,122 K246N probably damaging Het
Klhl32 T C 4: 24,629,195 D524G probably null Het
Lax1 A G 1: 133,680,596 S136P possibly damaging Het
Lefty1 A G 1: 180,937,160 K217E probably benign Het
Lgr5 A G 10: 115,478,525 L169P probably damaging Het
Mad1l1 A T 5: 140,315,055 S29T possibly damaging Het
Man1a T C 10: 54,074,795 H77R probably benign Het
Met C T 6: 17,558,733 S1120F probably damaging Het
Mfsd4b2 A T 10: 39,921,609 I250N probably damaging Het
Myod1 A G 7: 46,376,881 H70R possibly damaging Het
Neb T C 2: 52,212,692 N4280S probably benign Het
Nudt6 T C 3: 37,419,489 T28A possibly damaging Het
Nup85 A G 11: 115,583,734 E628G probably damaging Het
Oaz3 A T 3: 94,434,988 D120E probably damaging Het
Olfr1031 C A 2: 85,991,941 N41K probably damaging Het
Olfr1105 C T 2: 87,033,289 A311T probably benign Het
Olfr131 A T 17: 38,082,729 M83K probably damaging Het
Olfr1454 A T 19: 13,063,345 probably benign Het
Olfr786 A C 10: 129,436,943 I44L probably damaging Het
Osbpl8 A T 10: 111,273,068 K404* probably null Het
Pcdhga2 A G 18: 37,670,905 N601D probably damaging Het
Pld2 T C 11: 70,554,675 Y638H probably damaging Het
Prickle2 C G 6: 92,458,615 V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 R125C probably benign Het
Rnaset2b G A 17: 6,991,694 V24I probably benign Het
Rusc2 A T 4: 43,416,416 D574V probably benign Het
Scn8a T A 15: 100,940,115 probably null Het
Sec11a T C 7: 80,923,131 E134G probably benign Het
Senp5 A G 16: 31,989,884 V157A probably damaging Het
Shkbp1 C T 7: 27,351,695 probably null Het
Slc43a1 T C 2: 84,859,784 L435P probably damaging Het
Spn G A 7: 127,136,723 P204L possibly damaging Het
Srr T A 11: 74,910,202 Q173L probably damaging Het
Star C G 8: 25,811,807 T222S probably benign Het
Timm22 T A 11: 76,411,127 Y93N probably damaging Het
Tmc4 G T 7: 3,675,459 Q58K probably benign Het
Tmem86b C T 7: 4,629,836 M1I probably null Het
Tmtc2 A T 10: 105,369,970 I488N probably damaging Het
Tnxb A T 17: 34,694,388 Y1792F probably damaging Het
Tph1 T A 7: 46,647,443 R443W possibly damaging Het
Ttyh1 T A 7: 4,129,324 V253E possibly damaging Het
Usf3 A G 16: 44,218,577 D1140G probably benign Het
Usp10 T C 8: 119,941,316 S118P probably benign Het
Vmn2r63 C T 7: 42,903,297 C845Y probably benign Het
Vmn2r72 G T 7: 85,751,174 F222L probably damaging Het
Zfp654 G A 16: 64,786,094 Q582* probably null Het
Zfp791 C T 8: 85,119,650 probably benign Het
Zfp879 T A 11: 50,838,475 D32V probably damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 unclassified probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTGGGCCCATTGATGTGAAC -3'
(R):5'- AATTGAAGGCCCTCTTTCGTTC -3'

Sequencing Primer
(F):5'- CCCATTGATGTGAACAGGCTG -3'
(R):5'- GTTCTCAATCCCAAACCCCGG -3'
Posted On2018-04-27