Incidental Mutation 'R6362:Senp5'
ID512548
Institutional Source Beutler Lab
Gene Symbol Senp5
Ensembl Gene ENSMUSG00000022772
Gene NameSUMO/sentrin specific peptidase 5
Synonyms6230429P13Rik, A730063F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6362 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location31959672-32003287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31989884 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000115257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023457] [ENSMUST00000129900] [ENSMUST00000155515] [ENSMUST00000231360]
Predicted Effect probably damaging
Transcript: ENSMUST00000023457
AA Change: V184A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023457
Gene: ENSMUSG00000022772
AA Change: V184A

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Pfam:Peptidase_C48 575 747 3.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121984
Predicted Effect probably damaging
Transcript: ENSMUST00000129900
AA Change: V157A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115257
Gene: ENSMUSG00000022772
AA Change: V157A

DomainStartEndE-ValueType
low complexity region 414 425 N/A INTRINSIC
Pfam:Peptidase_C48 548 603 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144320
Predicted Effect probably benign
Transcript: ENSMUST00000155515
SMART Domains Protein: ENSMUSP00000117481
Gene: ENSMUSG00000022772

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Peptidase_C48 156 208 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231360
AA Change: V184A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232628
Meta Mutation Damage Score 0.1979 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F07Rik T G 2: 173,528,174 probably null Het
Aldh5a1 T G 13: 24,918,550 D310A probably benign Het
Als2cl T A 9: 110,895,446 probably null Het
Amacr C A 15: 10,984,805 R170S probably damaging Het
Brwd1 C T 16: 96,002,307 R2221Q probably damaging Het
Cacna1g A T 11: 94,439,707 probably null Het
Cd3d G A 9: 44,986,291 D157N probably damaging Het
Cep131 T C 11: 120,064,690 D1043G probably damaging Het
Cit A G 5: 115,886,676 D326G probably benign Het
Col16a1 G C 4: 130,066,190 G370R unknown Het
Col6a3 T A 1: 90,810,563 Y1078F probably damaging Het
Colgalt2 A C 1: 152,471,798 Y161S probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Daxx G A 17: 33,911,364 V118I probably damaging Het
Dennd5a G T 7: 109,934,265 C75* probably null Het
Diaph3 A G 14: 86,772,130 L1071P probably damaging Het
Disp3 A G 4: 148,254,308 L802P possibly damaging Het
Dmc1 A G 15: 79,588,823 V141A probably benign Het
Dsc2 A T 18: 20,035,463 Y45* probably null Het
Dspp A G 5: 104,176,034 I348V probably benign Het
Epb42 C A 2: 121,025,779 C428F possibly damaging Het
Fam227a G T 15: 79,643,350 P100Q possibly damaging Het
Fer1l4 C T 2: 156,048,250 V252I probably benign Het
Fhod1 C A 8: 105,331,641 probably null Het
Fhod3 G T 18: 24,754,255 A68S probably benign Het
Gatm T C 2: 122,598,196 D328G probably benign Het
Gm13103 A G 4: 143,852,865 Y340C probably damaging Het
Gm6401 G T 14: 41,967,770 H44N probably benign Het
Gm884 G C 11: 103,620,652 N163K unknown Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr84 G A 15: 103,308,510 A380V probably damaging Het
Herc1 G T 9: 66,471,908 W3492L probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Jag2 T A 12: 112,920,122 K246N probably damaging Het
Klhl32 T C 4: 24,629,195 D524G probably null Het
Lax1 A G 1: 133,680,596 S136P possibly damaging Het
Lefty1 A G 1: 180,937,160 K217E probably benign Het
Lgr5 A G 10: 115,478,525 L169P probably damaging Het
Mad1l1 A T 5: 140,315,055 S29T possibly damaging Het
Man1a T C 10: 54,074,795 H77R probably benign Het
Met C T 6: 17,558,733 S1120F probably damaging Het
Mfsd4b2 A T 10: 39,921,609 I250N probably damaging Het
Myod1 A G 7: 46,376,881 H70R possibly damaging Het
Neb T C 2: 52,212,692 N4280S probably benign Het
Nudt6 T C 3: 37,419,489 T28A possibly damaging Het
Nup85 A G 11: 115,583,734 E628G probably damaging Het
Oaz3 A T 3: 94,434,988 D120E probably damaging Het
Olfr1031 C A 2: 85,991,941 N41K probably damaging Het
Olfr1105 C T 2: 87,033,289 A311T probably benign Het
Olfr131 A T 17: 38,082,729 M83K probably damaging Het
Olfr1454 A T 19: 13,063,345 probably benign Het
Olfr786 A C 10: 129,436,943 I44L probably damaging Het
Osbpl8 A T 10: 111,273,068 K404* probably null Het
Pcdhga2 A G 18: 37,670,905 N601D probably damaging Het
Pld2 T C 11: 70,554,675 Y638H probably damaging Het
Prickle2 C G 6: 92,458,615 V2L possibly damaging Het
Psmd6 G A 14: 14,116,949 R125C probably benign Het
Rnaset2b G A 17: 6,991,694 V24I probably benign Het
Rusc2 A T 4: 43,416,416 D574V probably benign Het
Scn8a T A 15: 100,940,115 probably null Het
Sec11a T C 7: 80,923,131 E134G probably benign Het
Shkbp1 C T 7: 27,351,695 probably null Het
Slc43a1 T C 2: 84,859,784 L435P probably damaging Het
Spn G A 7: 127,136,723 P204L possibly damaging Het
Srr T A 11: 74,910,202 Q173L probably damaging Het
Star C G 8: 25,811,807 T222S probably benign Het
Timm22 T A 11: 76,411,127 Y93N probably damaging Het
Tmc4 G T 7: 3,675,459 Q58K probably benign Het
Tmem86b C T 7: 4,629,836 M1I probably null Het
Tmtc2 A T 10: 105,369,970 I488N probably damaging Het
Tnxb A T 17: 34,694,388 Y1792F probably damaging Het
Tph1 T A 7: 46,647,443 R443W possibly damaging Het
Ttyh1 T A 7: 4,129,324 V253E possibly damaging Het
Usf3 A G 16: 44,218,577 D1140G probably benign Het
Usp10 T C 8: 119,941,316 S118P probably benign Het
Vmn2r63 C T 7: 42,903,297 C845Y probably benign Het
Vmn2r72 G T 7: 85,751,174 F222L probably damaging Het
Zfp654 G A 16: 64,786,094 Q582* probably null Het
Zfp791 C T 8: 85,119,650 probably benign Het
Zfp879 T A 11: 50,838,475 D32V probably damaging Het
Other mutations in Senp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Senp5 APN 16 31989173 missense probably damaging 1.00
IGL00990:Senp5 APN 16 31990274 missense probably benign 0.00
IGL01707:Senp5 APN 16 31989770 missense probably damaging 0.99
IGL01923:Senp5 APN 16 31965816 missense probably damaging 1.00
IGL01997:Senp5 APN 16 31963470 missense probably damaging 0.97
IGL02273:Senp5 APN 16 31989872 missense probably benign 0.14
IGL02560:Senp5 APN 16 31989392 missense probably benign
IGL02651:Senp5 APN 16 31990079 missense probably benign 0.04
IGL02830:Senp5 APN 16 31983485 splice site probably benign
R0578:Senp5 UTSW 16 31989345 missense possibly damaging 0.75
R1879:Senp5 UTSW 16 31983824 missense probably damaging 1.00
R2153:Senp5 UTSW 16 31968874 missense probably damaging 1.00
R4903:Senp5 UTSW 16 31983299 missense probably damaging 1.00
R5092:Senp5 UTSW 16 31989142 missense probably benign 0.00
R5590:Senp5 UTSW 16 31989513 missense probably damaging 0.99
R6346:Senp5 UTSW 16 31983847 missense probably damaging 1.00
R6762:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R7002:Senp5 UTSW 16 31983775 missense probably damaging 1.00
R7027:Senp5 UTSW 16 31989295 missense probably benign
R7436:Senp5 UTSW 16 31976029 missense unknown
R7721:Senp5 UTSW 16 31990434 start codon destroyed unknown
Predicted Primers PCR Primer
(F):5'- CTGGGATCTGAAAATCCTATACCG -3'
(R):5'- AGTCTCCTGAAACTCCAAGCAG -3'

Sequencing Primer
(F):5'- GGATCTGAAAATCCTATACCGAAATC -3'
(R):5'- GAGCTTGGACCATAAATACTGC -3'
Posted On2018-04-27