Incidental Mutation 'R6363:Rev1'
ID512561
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene NameREV1, DNA directed polymerase
SynonymsREV1, Rev1l, 1110027I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R6363 (G1)
Quality Score224.009
Status Validated
Chromosome1
Chromosomal Location38052786-38129801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38071489 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 560 (H560L)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251]
PDB Structure
Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027251
AA Change: H560L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: H560L

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192697
Predicted Effect probably benign
Transcript: ENSMUST00000193472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Predicted Effect probably benign
Transcript: ENSMUST00000194815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195028
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38098940 missense probably damaging 1.00
IGL01065:Rev1 APN 1 38099009 missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38092063 missense probably damaging 1.00
IGL03003:Rev1 APN 1 38088073 missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38056767 missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38056256 unclassified probably benign
R0409:Rev1 UTSW 1 38074368 nonsense probably null
R0606:Rev1 UTSW 1 38059123 missense probably null 1.00
R1134:Rev1 UTSW 1 38057687 missense probably benign 0.04
R1171:Rev1 UTSW 1 38088500 missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38059118 unclassified probably benign
R1440:Rev1 UTSW 1 38088205 missense probably damaging 1.00
R1485:Rev1 UTSW 1 38088572 missense probably benign 0.00
R1627:Rev1 UTSW 1 38055490 missense probably damaging 0.99
R3845:Rev1 UTSW 1 38098988 missense probably damaging 0.99
R3948:Rev1 UTSW 1 38074333 missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38107648 missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38108419 missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38059194 missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38053649 missense probably damaging 1.00
R4654:Rev1 UTSW 1 38079256 intron probably benign
R5032:Rev1 UTSW 1 38074489 intron probably benign
R5286:Rev1 UTSW 1 38055326 nonsense probably null
R5311:Rev1 UTSW 1 38079393 missense probably benign 0.00
R5327:Rev1 UTSW 1 38108451 nonsense probably null
R7050:Rev1 UTSW 1 38054271 missense probably damaging 1.00
R7072:Rev1 UTSW 1 38067545 nonsense probably null
R7132:Rev1 UTSW 1 38071449 missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38085601 missense probably damaging 1.00
R7298:Rev1 UTSW 1 38053104 missense probably damaging 1.00
R7367:Rev1 UTSW 1 38074407 nonsense probably null
R7395:Rev1 UTSW 1 38088065 missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38056445 missense probably damaging 0.98
R8053:Rev1 UTSW 1 38063141 missense possibly damaging 0.67
X0017:Rev1 UTSW 1 38053661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCATAATCTGTGTAACCCAG -3'
(R):5'- TCCAGTCGTTTCTGCTGTAG -3'

Sequencing Primer
(F):5'- GTAACTTATTATTCAGCTTGGCGAG -3'
(R):5'- GAACACTAGCTTTGTATCAGAGTCAG -3'
Posted On2018-04-27