Incidental Mutation 'R6363:Ptgfrn'
ID 512571
Institutional Source Beutler Lab
Gene Symbol Ptgfrn
Ensembl Gene ENSMUSG00000027864
Gene Name prostaglandin F2 receptor negative regulator
Synonyms CD9P-1, 4833445A08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6363 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 101040232-101110278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 101045578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 780 (V780A)
Ref Sequence ENSEMBL: ENSMUSP00000099755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102694]
AlphaFold Q9WV91
Predicted Effect possibly damaging
Transcript: ENSMUST00000102694
AA Change: V780A

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: V780A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 38 121 3.01e-7 SMART
IG 154 264 1.54e-4 SMART
IG 284 390 1.11e-5 SMART
IG 414 532 1.72e-2 SMART
IG 556 676 9.71e-2 SMART
IG 696 822 5.21e-2 SMART
transmembrane domain 831 853 N/A INTRINSIC
low complexity region 862 872 N/A INTRINSIC
Meta Mutation Damage Score 0.2216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Ptgfrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Ptgfrn APN 3 101072845 missense probably benign 0.01
IGL01710:Ptgfrn APN 3 101073088 missense probably damaging 0.98
IGL02557:Ptgfrn APN 3 101060636 critical splice donor site probably null
IGL02740:Ptgfrn APN 3 101072937 missense possibly damaging 0.84
IGL02817:Ptgfrn APN 3 101060752 missense probably benign
IGL02948:Ptgfrn APN 3 101072819 missense probably benign 0.21
R1540:Ptgfrn UTSW 3 101060654 missense probably benign 0.41
R1563:Ptgfrn UTSW 3 101060651 missense possibly damaging 0.67
R1730:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1766:Ptgfrn UTSW 3 101050122 missense probably benign 0.00
R1783:Ptgfrn UTSW 3 101056442 missense possibly damaging 0.71
R1918:Ptgfrn UTSW 3 101056307 missense probably benign
R2113:Ptgfrn UTSW 3 101077309 missense probably benign 0.00
R2290:Ptgfrn UTSW 3 101077361 missense possibly damaging 0.77
R3522:Ptgfrn UTSW 3 101043402 missense probably damaging 1.00
R5223:Ptgfrn UTSW 3 101045593 missense probably benign 0.13
R5600:Ptgfrn UTSW 3 101056250 missense probably damaging 0.99
R5642:Ptgfrn UTSW 3 101043362 missense probably damaging 1.00
R5927:Ptgfrn UTSW 3 101060652 missense possibly damaging 0.92
R5984:Ptgfrn UTSW 3 101050143 missense probably damaging 0.99
R6124:Ptgfrn UTSW 3 101073089 missense probably damaging 0.98
R6331:Ptgfrn UTSW 3 101045620 missense possibly damaging 0.64
R6473:Ptgfrn UTSW 3 101045639 missense probably damaging 1.00
R6856:Ptgfrn UTSW 3 101045446 missense probably damaging 1.00
R7151:Ptgfrn UTSW 3 101080195 nonsense probably null
R7313:Ptgfrn UTSW 3 101073047 missense possibly damaging 0.84
R7361:Ptgfrn UTSW 3 101077444 missense probably benign 0.03
R7806:Ptgfrn UTSW 3 101077132 missense possibly damaging 0.50
R7823:Ptgfrn UTSW 3 101043409 missense probably damaging 1.00
R7841:Ptgfrn UTSW 3 101060810 missense probably damaging 0.98
R8093:Ptgfrn UTSW 3 101056437 missense probably benign 0.19
R8093:Ptgfrn UTSW 3 101072941 missense probably benign 0.09
R8490:Ptgfrn UTSW 3 101056370 missense probably damaging 0.99
R8856:Ptgfrn UTSW 3 101056611 missense possibly damaging 0.86
Z1088:Ptgfrn UTSW 3 101056437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATGTGCTGCAGTACAACTCG -3'
(R):5'- ACACTCTGACCTCAGCATTTGG -3'

Sequencing Primer
(F):5'- CTCGGGAAGATACTTAGATACCCAG -3'
(R):5'- TGGCTCCGTAATCCACAGATG -3'
Posted On 2018-04-27