Incidental Mutation 'R6363:Ttyh3'
ID512579
Institutional Source Beutler Lab
Gene Symbol Ttyh3
Ensembl Gene ENSMUSG00000036565
Gene Nametweety family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6363 (G1)
Quality Score202.009
Status Validated
Chromosome5
Chromosomal Location140620578-140649031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140635224 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 195 (L195Q)
Ref Sequence ENSEMBL: ENSMUSP00000142655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042661] [ENSMUST00000197452]
Predicted Effect probably damaging
Transcript: ENSMUST00000042661
AA Change: L195Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037447
Gene: ENSMUSG00000036565
AA Change: L195Q

DomainStartEndE-ValueType
Pfam:Tweety 25 430 9.4e-183 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000197452
AA Change: L195Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142655
Gene: ENSMUSG00000036565
AA Change: L195Q

DomainStartEndE-ValueType
Pfam:Tweety 25 430 1.8e-182 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198765
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tweety family of proteins. Members of this family function as chloride anion channels. The encoded protein functions as a calcium(2+)-activated large conductance chloride(-) channel. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Ttyh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Ttyh3 APN 5 140629412 missense probably damaging 0.99
IGL01324:Ttyh3 APN 5 140631513 missense probably benign 0.00
IGL01982:Ttyh3 APN 5 140636074 splice site probably benign
IGL02002:Ttyh3 APN 5 140629483 missense probably damaging 1.00
IGL02218:Ttyh3 APN 5 140626491 missense probably damaging 1.00
IGL02385:Ttyh3 APN 5 140633305 missense probably benign 0.03
IGL02510:Ttyh3 APN 5 140629464 missense probably damaging 1.00
R0843:Ttyh3 UTSW 5 140626446 splice site probably null
R3037:Ttyh3 UTSW 5 140648842 start gained probably benign
R3774:Ttyh3 UTSW 5 140648734 missense probably damaging 0.99
R4795:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4796:Ttyh3 UTSW 5 140634786 missense probably damaging 1.00
R4868:Ttyh3 UTSW 5 140629466 missense probably damaging 1.00
R5671:Ttyh3 UTSW 5 140631552 missense probably benign 0.02
R6107:Ttyh3 UTSW 5 140633562 critical splice donor site probably null
R7104:Ttyh3 UTSW 5 140629785 missense probably benign 0.00
R7454:Ttyh3 UTSW 5 140629425 missense possibly damaging 0.95
R7798:Ttyh3 UTSW 5 140634783 missense probably damaging 1.00
R7810:Ttyh3 UTSW 5 140625141 missense
Predicted Primers PCR Primer
(F):5'- TTGAAGAAGACAGCACCTCC -3'
(R):5'- ACCTGGCTCTGACTTATATTGC -3'

Sequencing Primer
(F):5'- AGCACCTCCTCCCACGG -3'
(R):5'- CTCCTCTTAAAGGTGTGGGAC -3'
Posted On2018-04-27