Incidental Mutation 'R6363:Cyp3a41b'
ID512580
Institutional Source Beutler Lab
Gene Symbol Cyp3a41b
Ensembl Gene ENSMUSG00000075552
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 41B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6363 (G1)
Quality Score152.008
Status Not validated
Chromosome5
Chromosomal Location145558664-145584730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145570387 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 248 (F248I)
Ref Sequence ENSEMBL: ENSMUSP00000075234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075837]
Predicted Effect probably damaging
Transcript: ENSMUST00000075837
AA Change: F248I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075234
Gene: ENSMUSG00000075552
AA Change: F248I

DomainStartEndE-ValueType
Pfam:p450 38 494 1.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Cyp3a41b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cyp3a41b APN 5 145578200 splice site probably benign
IGL02341:Cyp3a41b APN 5 145573651 missense probably benign 0.34
R0284:Cyp3a41b UTSW 5 145578204 splice site probably benign
R1857:Cyp3a41b UTSW 5 145566850 missense probably benign 0.06
R2269:Cyp3a41b UTSW 5 145578166 missense probably benign 0.10
R2360:Cyp3a41b UTSW 5 145570411 missense probably benign
R4299:Cyp3a41b UTSW 5 145573677 missense possibly damaging 0.85
R4801:Cyp3a41b UTSW 5 145573651 missense probably benign 0.34
R4802:Cyp3a41b UTSW 5 145573651 missense probably benign 0.34
R5911:Cyp3a41b UTSW 5 145582539 missense probably benign 0.01
R7198:Cyp3a41b UTSW 5 145582520 missense probably benign 0.00
R7410:Cyp3a41b UTSW 5 145578157 missense probably damaging 0.99
R8221:Cyp3a41b UTSW 5 145569380 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAACTCCAACTTCTCCTCTATGAG -3'
(R):5'- GAGCAAGTTCATAGAGAGAATGACTTC -3'

Sequencing Primer
(F):5'- GTTCACAGCCCAACATGT -3'
(R):5'- GAGAATGACTTCTGTTTGAGACACTG -3'
Posted On2018-04-27