Mutagenetix > Incidental Mutations

Incidental Mutation 'R6363:Slc8a2'

512582

Institutional Source

Beutler Lab

Gene Symbol

Slc8a2

Ensembl Gene

ENSMUSG00000030376

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 2

Synonyms

Ncx2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R6363 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

16129826-16161063 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 16134045 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 67 (D67E)

Ref Sequence

ENSEMBL: ENSMUSP00000147497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]

Predicted Effect

probably benign
Transcript: ENSMUST00000168693
AA Change: D67E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: D67E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	23	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	74	245	8.6e-35	PFAM
Pfam:Na_Ca_ex_C	248	378	7.8e-50	PFAM
Calx_beta	383	483	3.27e-47	SMART
Calx_beta	512	612	3.37e-49	SMART
low complexity region	704	717	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	2.5e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000211649
AA Change: D67E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

Meta Mutation Damage Score

0.0647

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.9%

Validation Efficiency

98% (51/52)

MGI Phenotype

PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl4	A	G	4: 111,566,785		probably benign	Het
Antxrl	G	T	14: 34,069,287	C379F	probably damaging	Het
Camsap3	T	C	8: 3,601,971	C256R	probably damaging	Het
Ccdc33	T	C	9: 58,114,335	E254G	probably benign	Het
Ccndbp1	C	T	2: 121,012,973	P282L	probably damaging	Het
Col5a1	C	T	2: 27,928,195	T144I	unknown	Het
Csmd2	A	T	4: 128,400,379	H1167L	probably benign	Het
Ctsk	A	T	3: 95,501,551	T82S	probably damaging	Het
Cyp3a41b	A	T	5: 145,570,387	F248I	probably damaging	Het
Dchs1	A	G	7: 105,758,472	I2051T	probably benign	Het
Dnah17	A	G	11: 118,110,505	F871L	probably benign	Het
Eif2b4	A	G	5: 31,191,239	V210A	probably damaging	Het
Eral1	A	G	11: 78,074,317	I385T	probably damaging	Het
Ercc8	T	C	13: 108,183,870	L330P	probably damaging	Het
Etfa	A	G	9: 55,500,133	V24A	probably damaging	Het
Fcrl1	A	T	3: 87,385,168	I156F	probably damaging	Het
Gm7298	A	G	6: 121,788,606	Y1465C	probably damaging	Het
Gpr17	A	G	18: 31,947,572	L146P	probably damaging	Het
Gpr171	A	G	3: 59,097,892	I154T	possibly damaging	Het
Hid1	T	A	11: 115,352,596	Y542F	probably damaging	Het
Hspa8	T	C	9: 40,803,065	V219A	probably damaging	Het
Klhl24	C	T	16: 20,120,183	T496I	possibly damaging	Het
Krtcap2	T	C	3: 89,249,106	S64P	probably damaging	Het
Msh3	C	A	13: 92,212,524	D1066Y	probably damaging	Het
Naaladl2	C	T	3: 24,335,317	G323R	possibly damaging	Het
Nbas	A	G	12: 13,482,576	T1762A	probably benign	Het
Nr4a1	C	T	15: 101,274,115	R557C	probably damaging	Het
Ogfrl1	T	A	1: 23,370,113	H344L	probably benign	Het
Olfr476	A	G	7: 107,967,750	M118V	possibly damaging	Het
Olfr539	T	A	7: 140,668,082	F265Y	possibly damaging	Het
Olfr76	T	A	19: 12,120,166	H182L	possibly damaging	Het
Olfr827	A	C	10: 130,211,037	V31G	possibly damaging	Het
Orm2	G	A	4: 63,362,604		probably null	Het
Patj	T	A	4: 98,431,860	S455T	probably benign	Het
Pdgfra	G	T	5: 75,170,836	V336L	possibly damaging	Het
Prkaa1	T	C	15: 5,176,956	L431S	probably damaging	Het
Ptgfrn	A	G	3: 101,045,578	V780A	possibly damaging	Het
Rb1	A	T	14: 73,287,641	V184E	probably benign	Het
Rev1	T	A	1: 38,071,489	H560L	probably damaging	Het
Serpinb13	A	T	1: 107,000,774	R375*	probably null	Het
Sos2	A	T	12: 69,632,111	N307K	probably benign	Het
Srgap2	G	A	1: 131,298,468	R36W	probably damaging	Het
Tas2r119	G	T	15: 32,177,888	W200L	possibly damaging	Het
Tep1	T	G	14: 50,824,548	K2575T	probably benign	Het
Ttc36	T	A	9: 44,799,639	R131S	probably damaging	Het
Ttyh3	A	T	5: 140,635,224	L195Q	probably damaging	Het
Uba7	G	A	9: 107,980,183		probably null	Het
Utp20	A	C	10: 88,757,080	V2249G	probably damaging	Het
Wwc2	A	T	8: 47,887,162		probably null	Het
Zdhhc21	A	T	4: 82,847,674	V8D	probably damaging	Het
Zfp719	A	G	7: 43,589,866	T293A	probably benign	Het

Other mutations in Slc8a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01778:Slc8a2	APN	7	16158893	missense	probably damaging	1.00
IGL02097:Slc8a2	APN	7	16157156	missense	possibly damaging	0.88
IGL02744:Slc8a2	APN	7	16145029	missense	possibly damaging	0.91
PIT4402001:Slc8a2	UTSW	7	16134494	missense	probably damaging	1.00
PIT4515001:Slc8a2	UTSW	7	16140579	missense	possibly damaging	0.69
R0281:Slc8a2	UTSW	7	16140989	missense	probably benign
R0513:Slc8a2	UTSW	7	16157339	missense	probably damaging	1.00
R0811:Slc8a2	UTSW	7	16141114	missense	probably damaging	1.00
R0812:Slc8a2	UTSW	7	16141114	missense	probably damaging	1.00
R0940:Slc8a2	UTSW	7	16144962	missense	probably benign	0.04
R1167:Slc8a2	UTSW	7	16157387	missense	possibly damaging	0.58
R1508:Slc8a2	UTSW	7	16140597	missense	probably benign	0.00
R1655:Slc8a2	UTSW	7	16141135	missense	probably damaging	1.00
R1917:Slc8a2	UTSW	7	16152920	missense	probably benign	0.11
R1919:Slc8a2	UTSW	7	16152920	missense	probably benign	0.11
R2051:Slc8a2	UTSW	7	16141015	missense	probably damaging	1.00
R2083:Slc8a2	UTSW	7	16134515	missense	probably damaging	1.00
R2128:Slc8a2	UTSW	7	16140492	splice site	probably null
R2149:Slc8a2	UTSW	7	16159164	missense	probably damaging	1.00
R3437:Slc8a2	UTSW	7	16158885	missense	probably damaging	1.00
R3618:Slc8a2	UTSW	7	16152899	missense	possibly damaging	0.48
R4645:Slc8a2	UTSW	7	16134239	missense	probably damaging	1.00
R4741:Slc8a2	UTSW	7	16134308	missense	probably damaging	1.00
R4936:Slc8a2	UTSW	7	16134175	nonsense	probably null
R5071:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5072:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5074:Slc8a2	UTSW	7	16150583	missense	possibly damaging	0.84
R5150:Slc8a2	UTSW	7	16145176	missense	possibly damaging	0.74
R5358:Slc8a2	UTSW	7	16157303	missense	probably damaging	1.00
R5839:Slc8a2	UTSW	7	16134487	missense	probably damaging	1.00
R5957:Slc8a2	UTSW	7	16145284	missense	possibly damaging	0.90
R6273:Slc8a2	UTSW	7	16145334	missense	possibly damaging	0.94
R6881:Slc8a2	UTSW	7	16157357	missense	probably damaging	1.00
R7084:Slc8a2	UTSW	7	16145038	missense	probably benign	0.17
R7211:Slc8a2	UTSW	7	16140613	missense	possibly damaging	0.87
R7227:Slc8a2	UTSW	7	16144981	missense	possibly damaging	0.73
R7278:Slc8a2	UTSW	7	16141152	missense	probably damaging	1.00
R7380:Slc8a2	UTSW	7	16134353	missense	probably damaging	1.00
R8239:Slc8a2	UTSW	7	16145305	missense	probably benign	0.00
Z1177:Slc8a2	UTSW	7	16140987	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- AATGGCTCCCTTGGCTTTGATG -3'
(R):5'- TGAGTGTAAGGTTGGACACC -3'

Sequencing Primer
(F):5'- GATGGGGGTTGTTCTCCTTC -3'
(R):5'- GACACCGTCTCGTTCCAGATG -3'

Posted On

2018-04-27