Incidental Mutation 'R6363:Slc8a2'
ID512582
Institutional Source Beutler Lab
Gene Symbol Slc8a2
Ensembl Gene ENSMUSG00000030376
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 2
SynonymsNcx2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16129826-16161063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16134045 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 67 (D67E)
Ref Sequence ENSEMBL: ENSMUSP00000147497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168693] [ENSMUST00000211649]
Predicted Effect probably benign
Transcript: ENSMUST00000168693
AA Change: D67E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128926
Gene: ENSMUSG00000030376
AA Change: D67E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 32 N/A INTRINSIC
Pfam:Na_Ca_ex 74 245 8.6e-35 PFAM
Pfam:Na_Ca_ex_C 248 378 7.8e-50 PFAM
Calx_beta 383 483 3.27e-47 SMART
Calx_beta 512 612 3.37e-49 SMART
low complexity region 704 717 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 2.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211649
AA Change: D67E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: The clearance of elevated calcium following depolarization is delayed in homozygous mutant mice, which exhibit enhanced learning and memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Slc8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Slc8a2 APN 7 16158893 missense probably damaging 1.00
IGL02097:Slc8a2 APN 7 16157156 missense possibly damaging 0.88
IGL02744:Slc8a2 APN 7 16145029 missense possibly damaging 0.91
PIT4402001:Slc8a2 UTSW 7 16134494 missense probably damaging 1.00
PIT4515001:Slc8a2 UTSW 7 16140579 missense possibly damaging 0.69
R0281:Slc8a2 UTSW 7 16140989 missense probably benign
R0513:Slc8a2 UTSW 7 16157339 missense probably damaging 1.00
R0811:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0812:Slc8a2 UTSW 7 16141114 missense probably damaging 1.00
R0940:Slc8a2 UTSW 7 16144962 missense probably benign 0.04
R1167:Slc8a2 UTSW 7 16157387 missense possibly damaging 0.58
R1508:Slc8a2 UTSW 7 16140597 missense probably benign 0.00
R1655:Slc8a2 UTSW 7 16141135 missense probably damaging 1.00
R1917:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R1919:Slc8a2 UTSW 7 16152920 missense probably benign 0.11
R2051:Slc8a2 UTSW 7 16141015 missense probably damaging 1.00
R2083:Slc8a2 UTSW 7 16134515 missense probably damaging 1.00
R2128:Slc8a2 UTSW 7 16140492 splice site probably null
R2149:Slc8a2 UTSW 7 16159164 missense probably damaging 1.00
R3437:Slc8a2 UTSW 7 16158885 missense probably damaging 1.00
R3618:Slc8a2 UTSW 7 16152899 missense possibly damaging 0.48
R4645:Slc8a2 UTSW 7 16134239 missense probably damaging 1.00
R4741:Slc8a2 UTSW 7 16134308 missense probably damaging 1.00
R4936:Slc8a2 UTSW 7 16134175 nonsense probably null
R5071:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5072:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5074:Slc8a2 UTSW 7 16150583 missense possibly damaging 0.84
R5150:Slc8a2 UTSW 7 16145176 missense possibly damaging 0.74
R5358:Slc8a2 UTSW 7 16157303 missense probably damaging 1.00
R5839:Slc8a2 UTSW 7 16134487 missense probably damaging 1.00
R5957:Slc8a2 UTSW 7 16145284 missense possibly damaging 0.90
R6273:Slc8a2 UTSW 7 16145334 missense possibly damaging 0.94
R6881:Slc8a2 UTSW 7 16157357 missense probably damaging 1.00
R7084:Slc8a2 UTSW 7 16145038 missense probably benign 0.17
R7211:Slc8a2 UTSW 7 16140613 missense possibly damaging 0.87
R7227:Slc8a2 UTSW 7 16144981 missense possibly damaging 0.73
R7278:Slc8a2 UTSW 7 16141152 missense probably damaging 1.00
R7380:Slc8a2 UTSW 7 16134353 missense probably damaging 1.00
Z1177:Slc8a2 UTSW 7 16140987 missense not run
Predicted Primers PCR Primer
(F):5'- AATGGCTCCCTTGGCTTTGATG -3'
(R):5'- TGAGTGTAAGGTTGGACACC -3'

Sequencing Primer
(F):5'- GATGGGGGTTGTTCTCCTTC -3'
(R):5'- GACACCGTCTCGTTCCAGATG -3'
Posted On2018-04-27