Incidental Mutation 'R6363:Olfr476'
ID512585
Institutional Source Beutler Lab
Gene Symbol Olfr476
Ensembl Gene ENSMUSG00000095301
Gene Nameolfactory receptor 476
SynonymsMOR204-3, GA_x6K02T2PBJ9-10296787-10297719
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107964803-107969514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107967750 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 118 (M118V)
Ref Sequence ENSEMBL: ENSMUSP00000149760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077249] [ENSMUST00000217173]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077249
AA Change: M118V

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076485
Gene: ENSMUSG00000095301
AA Change: M118V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 290 4.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217173
AA Change: M118V

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Olfr476
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr476 APN 7 107967534 missense probably damaging 1.00
IGL01403:Olfr476 APN 7 107967621 missense possibly damaging 0.64
IGL01564:Olfr476 APN 7 107967991 missense probably benign 0.11
IGL01615:Olfr476 APN 7 107967937 missense probably damaging 1.00
IGL01777:Olfr476 APN 7 107967502 missense probably damaging 1.00
IGL01999:Olfr476 APN 7 107967468 missense probably benign
IGL02239:Olfr476 APN 7 107968047 missense probably damaging 1.00
R0636:Olfr476 UTSW 7 107967472 missense probably benign 0.00
R1986:Olfr476 UTSW 7 107967670 missense probably benign
R5109:Olfr476 UTSW 7 107967897 missense probably benign 0.06
R6526:Olfr476 UTSW 7 107967462 missense probably benign 0.03
R6907:Olfr476 UTSW 7 107968252 missense probably damaging 1.00
R7063:Olfr476 UTSW 7 107968204 missense probably benign
R7218:Olfr476 UTSW 7 107967667 missense probably benign
R7240:Olfr476 UTSW 7 107968188 missense probably benign 0.42
R7444:Olfr476 UTSW 7 107967604 missense probably damaging 0.99
R7939:Olfr476 UTSW 7 107967779 nonsense probably null
R8060:Olfr476 UTSW 7 107967405 missense probably benign
X0025:Olfr476 UTSW 7 107968188 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGGGAAATTTCAGCATCATCAG -3'
(R):5'- ATCTGATTTGGTCCACAGAAGG -3'

Sequencing Primer
(F):5'- CAGTTTAATAAGAAGTTGCCCCC -3'
(R):5'- TCCACAGAAGGACAGAATCGACAG -3'
Posted On2018-04-27