Incidental Mutation 'R6363:Or13a25'
ID 512586
Institutional Source Beutler Lab
Gene Symbol Or13a25
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor family 13 subfamily A member 25
Synonyms GA_x6K02T2PBJ9-42813436-42814368, Olfr539, MOR253-4
MMRRC Submission 044513-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6363 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 140247202-140248161 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140247995 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 265 (F265Y)
Ref Sequence ENSEMBL: ENSMUSP00000077990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078967
AA Change: F265Y

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: F265Y

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect possibly damaging
Transcript: ENSMUST00000218865
AA Change: F258Y

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,423,982 (GRCm39) probably benign Het
Antxrl G T 14: 33,791,244 (GRCm39) C379F probably damaging Het
Camsap3 T C 8: 3,651,971 (GRCm39) C256R probably damaging Het
Ccdc33 T C 9: 58,021,618 (GRCm39) E254G probably benign Het
Ccndbp1 C T 2: 120,843,454 (GRCm39) P282L probably damaging Het
Col5a1 C T 2: 27,818,207 (GRCm39) T144I unknown Het
Csmd2 A T 4: 128,294,172 (GRCm39) H1167L probably benign Het
Ctsk A T 3: 95,408,862 (GRCm39) T82S probably damaging Het
Cyp3a41b A T 5: 145,507,197 (GRCm39) F248I probably damaging Het
Dchs1 A G 7: 105,407,679 (GRCm39) I2051T probably benign Het
Dnah17 A G 11: 118,001,331 (GRCm39) F871L probably benign Het
Eif2b4 A G 5: 31,348,583 (GRCm39) V210A probably damaging Het
Eral1 A G 11: 77,965,143 (GRCm39) I385T probably damaging Het
Ercc8 T C 13: 108,320,404 (GRCm39) L330P probably damaging Het
Etfa A G 9: 55,407,417 (GRCm39) V24A probably damaging Het
Fcrl1 A T 3: 87,292,475 (GRCm39) I156F probably damaging Het
Gm7298 A G 6: 121,765,565 (GRCm39) Y1465C probably damaging Het
Gpr17 A G 18: 32,080,625 (GRCm39) L146P probably damaging Het
Gpr171 A G 3: 59,005,313 (GRCm39) I154T possibly damaging Het
Hid1 T A 11: 115,243,422 (GRCm39) Y542F probably damaging Het
Hspa8 T C 9: 40,714,361 (GRCm39) V219A probably damaging Het
Klhl24 C T 16: 19,938,933 (GRCm39) T496I possibly damaging Het
Krtcap2 T C 3: 89,156,413 (GRCm39) S64P probably damaging Het
Msh3 C A 13: 92,349,032 (GRCm39) D1066Y probably damaging Het
Naaladl2 C T 3: 24,389,481 (GRCm39) G323R possibly damaging Het
Nbas A G 12: 13,532,577 (GRCm39) T1762A probably benign Het
Nr4a1 C T 15: 101,171,996 (GRCm39) R557C probably damaging Het
Ogfrl1 T A 1: 23,409,194 (GRCm39) H344L probably benign Het
Or5a1 T A 19: 12,097,530 (GRCm39) H182L possibly damaging Het
Or5p55 A G 7: 107,566,957 (GRCm39) M118V possibly damaging Het
Or9k7 A C 10: 130,046,906 (GRCm39) V31G possibly damaging Het
Orm2 G A 4: 63,280,841 (GRCm39) probably null Het
Patj T A 4: 98,320,097 (GRCm39) S455T probably benign Het
Pdgfra G T 5: 75,331,497 (GRCm39) V336L possibly damaging Het
Prkaa1 T C 15: 5,206,437 (GRCm39) L431S probably damaging Het
Ptgfrn A G 3: 100,952,894 (GRCm39) V780A possibly damaging Het
Rb1 A T 14: 73,525,081 (GRCm39) V184E probably benign Het
Rev1 T A 1: 38,110,570 (GRCm39) H560L probably damaging Het
Serpinb13 A T 1: 106,928,504 (GRCm39) R375* probably null Het
Slc8a2 C A 7: 15,867,970 (GRCm39) D67E probably benign Het
Sos2 A T 12: 69,678,885 (GRCm39) N307K probably benign Het
Srgap2 G A 1: 131,226,206 (GRCm39) R36W probably damaging Het
Tas2r119 G T 15: 32,178,034 (GRCm39) W200L possibly damaging Het
Tep1 T G 14: 51,062,005 (GRCm39) K2575T probably benign Het
Ttc36 T A 9: 44,710,936 (GRCm39) R131S probably damaging Het
Ttyh3 A T 5: 140,620,979 (GRCm39) L195Q probably damaging Het
Uba7 G A 9: 107,857,382 (GRCm39) probably null Het
Utp20 A C 10: 88,592,942 (GRCm39) V2249G probably damaging Het
Wwc2 A T 8: 48,340,197 (GRCm39) probably null Het
Zdhhc21 A T 4: 82,765,911 (GRCm39) V8D probably damaging Het
Zfp719 A G 7: 43,239,290 (GRCm39) T293A probably benign Het
Other mutations in Or13a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Or13a25 APN 7 140,247,854 (GRCm39) missense probably benign 0.01
IGL01610:Or13a25 APN 7 140,247,584 (GRCm39) missense probably damaging 1.00
IGL02959:Or13a25 APN 7 140,247,463 (GRCm39) missense probably damaging 1.00
IGL03406:Or13a25 APN 7 140,247,424 (GRCm39) missense probably damaging 1.00
R0671:Or13a25 UTSW 7 140,247,590 (GRCm39) missense probably damaging 1.00
R1771:Or13a25 UTSW 7 140,248,048 (GRCm39) missense probably benign
R1934:Or13a25 UTSW 7 140,247,951 (GRCm39) nonsense probably null
R1985:Or13a25 UTSW 7 140,247,734 (GRCm39) missense probably damaging 1.00
R2962:Or13a25 UTSW 7 140,247,862 (GRCm39) missense probably benign
R4239:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4240:Or13a25 UTSW 7 140,247,496 (GRCm39) missense probably benign 0.07
R4360:Or13a25 UTSW 7 140,247,730 (GRCm39) missense probably damaging 0.98
R4841:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4842:Or13a25 UTSW 7 140,247,502 (GRCm39) missense probably damaging 1.00
R4851:Or13a25 UTSW 7 140,247,226 (GRCm39) missense probably benign
R5325:Or13a25 UTSW 7 140,247,705 (GRCm39) missense probably benign 0.33
R5766:Or13a25 UTSW 7 140,247,266 (GRCm39) missense probably benign 0.02
R6836:Or13a25 UTSW 7 140,248,093 (GRCm39) missense possibly damaging 0.86
R7777:Or13a25 UTSW 7 140,247,854 (GRCm39) missense probably benign 0.01
R7920:Or13a25 UTSW 7 140,247,814 (GRCm39) missense possibly damaging 0.92
R8134:Or13a25 UTSW 7 140,247,680 (GRCm39) missense possibly damaging 0.90
R8712:Or13a25 UTSW 7 140,248,052 (GRCm39) missense possibly damaging 0.89
R9095:Or13a25 UTSW 7 140,247,813 (GRCm39) missense probably damaging 1.00
R9158:Or13a25 UTSW 7 140,247,547 (GRCm39) missense possibly damaging 0.76
R9603:Or13a25 UTSW 7 140,247,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACTCTTGTGGCAGATGC -3'
(R):5'- ACTGCTGTTGGGAAAGCATG -3'

Sequencing Primer
(F):5'- TGCATCATTGCCAGCATC -3'
(R):5'- GGCTAGGAGAACAGCATACCTATCTC -3'
Posted On 2018-04-27