Incidental Mutation 'R6363:Uba7'
ID512592
Institutional Source Beutler Lab
Gene Symbol Uba7
Ensembl Gene ENSMUSG00000032596
Gene Nameubiquitin-like modifier activating enzyme 7
Synonyms1300004C08Rik, Ube1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location107975505-107984060 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 107980183 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035216] [ENSMUST00000048568] [ENSMUST00000175914] [ENSMUST00000177368] [ENSMUST00000177392]
Predicted Effect probably null
Transcript: ENSMUST00000035216
SMART Domains Protein: ENSMUSP00000035216
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 6 401 1.2e-33 PFAM
Pfam:E1_FCCH 178 249 1.1e-26 PFAM
Pfam:E1_4HB 250 318 2.5e-22 PFAM
internal_repeat_1 402 510 8.05e-5 PROSPERO
Pfam:UBA_e1_thiolCys 592 808 1.3e-50 PFAM
UBA_e1_C 846 973 4.63e-65 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048568
SMART Domains Protein: ENSMUSP00000040433
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 52 73 N/A INTRINSIC
Pfam:FAM212 146 201 1.7e-30 PFAM
low complexity region 228 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075082
Predicted Effect probably benign
Transcript: ENSMUST00000175914
SMART Domains Protein: ENSMUSP00000134980
Gene: ENSMUSG00000042106

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176858
Predicted Effect probably benign
Transcript: ENSMUST00000177039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177096
Predicted Effect probably benign
Transcript: ENSMUST00000177368
SMART Domains Protein: ENSMUSP00000135553
Gene: ENSMUSG00000079323

DomainStartEndE-ValueType
Blast:UBA_e1_C 1 39 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000177392
SMART Domains Protein: ENSMUSP00000134910
Gene: ENSMUSG00000032596

DomainStartEndE-ValueType
Pfam:ThiF 22 153 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177494
Meta Mutation Damage Score 0.9583 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E1 ubiquitin-activating enzyme family. The encoded enzyme is a retinoid target that triggers promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha) degradation and apoptosis in acute promyelocytic leukemia, where it is involved in the conjugation of the ubiquitin-like interferon-stimulated gene 15 protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lacking ISG15 conjugation but not free ISG15 are healthy and fertile and exhibit normal antiviral responses against vesicular stomatitis virus and lymphocytic choriomeningitis virus infection. Bone-derived macrophages from mutant mice display normal responses to IFN treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Uba7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Uba7 APN 9 107979111 missense probably benign 0.31
IGL01696:Uba7 APN 9 107977348 missense probably damaging 1.00
IGL02137:Uba7 APN 9 107979753 splice site probably benign
IGL02272:Uba7 APN 9 107976153 missense probably benign 0.01
IGL02287:Uba7 APN 9 107978227 missense probably benign 0.10
IGL02430:Uba7 APN 9 107979468 splice site probably benign
IGL02552:Uba7 APN 9 107981390 missense probably benign 0.00
IGL02820:Uba7 APN 9 107981516 missense probably benign 0.01
IGL03234:Uba7 APN 9 107976400 missense probably damaging 0.97
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0013:Uba7 UTSW 9 107978249 missense probably damaging 1.00
R0717:Uba7 UTSW 9 107977217 missense probably benign 0.44
R2108:Uba7 UTSW 9 107979288 missense probably benign
R2253:Uba7 UTSW 9 107976364 missense probably benign 0.26
R4239:Uba7 UTSW 9 107976802 critical splice donor site probably null
R4528:Uba7 UTSW 9 107983903 missense possibly damaging 0.79
R4735:Uba7 UTSW 9 107976916 missense possibly damaging 0.94
R4736:Uba7 UTSW 9 107980165 missense probably benign 0.00
R4751:Uba7 UTSW 9 107979805 missense possibly damaging 0.66
R4937:Uba7 UTSW 9 107978991 missense possibly damaging 0.95
R4999:Uba7 UTSW 9 107979839 critical splice donor site probably null
R5020:Uba7 UTSW 9 107978914 missense probably benign
R5157:Uba7 UTSW 9 107980047 missense probably benign 0.04
R5214:Uba7 UTSW 9 107977514 intron probably benign
R5339:Uba7 UTSW 9 107978866 missense probably damaging 1.00
R5990:Uba7 UTSW 9 107981234 missense probably damaging 0.96
R6092:Uba7 UTSW 9 107983160 missense possibly damaging 0.96
R6110:Uba7 UTSW 9 107978939 missense probably benign 0.25
R6495:Uba7 UTSW 9 107977014 nonsense probably null
R6644:Uba7 UTSW 9 107981472 missense possibly damaging 0.55
R7032:Uba7 UTSW 9 107976172 missense possibly damaging 0.83
R7095:Uba7 UTSW 9 107983339 missense probably benign 0.01
R7517:Uba7 UTSW 9 107976698 splice site probably benign
X0024:Uba7 UTSW 9 107975945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCATCCCATCCCGTGTAC -3'
(R):5'- ATCAGCAAAGTAAGAGGCCC -3'

Sequencing Primer
(F):5'- TGTACCCACGGTCCTGC -3'
(R):5'- CTCCAGTTTCAGGGGATCGATAAAC -3'
Posted On2018-04-27