Incidental Mutation 'R6363:Sos2'
ID512599
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69632111 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 307 (N307K)
Ref Sequence ENSEMBL: ENSMUSP00000138589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
Predicted Effect probably benign
Transcript: ENSMUST00000035773
AA Change: N307K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: N307K

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182396
AA Change: N307K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: N307K

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183277
AA Change: N307K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: N307K

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 unclassified probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTGCACATTAAGAACTAACTGG -3'
(R):5'- GCCATAACTGTTGTTTTCCCTGAG -3'

Sequencing Primer
(F):5'- ACAGTGGCCTATGCTTACAG -3'
(R):5'- GTTGTTTTCCCTGAGTAGAGAAAAG -3'
Posted On2018-04-27