Incidental Mutation 'R6365:Ifi44l'
ID512620
Institutional Source Beutler Lab
Gene Symbol Ifi44l
Ensembl Gene ENSMUSG00000039146
Gene Nameinterferon-induced protein 44 like
SynonymsH-28, H28, NS1178
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151758737-151762892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151761505 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 63 (V63I)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000046739
AA Change: V63I
SMART Domains Protein: ENSMUSP00000044765
Gene: ENSMUSG00000039146
AA Change: V63I

DomainStartEndE-ValueType
low complexity region 140 154 N/A INTRINSIC
Meta Mutation Damage Score 0.0544 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a minor histocompatibility antigen that is involved in tissue graft rejection and is polymorphic in different mouse strains. The 5' region of this gene, including the translational start codon and the first 293 amino acids, is absent from the C57BL/6J genome. The encoded antigen is not thought to be expressed in C57BL/6J. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Ifi44l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02085:Ifi44l APN 3 151762840 missense unknown
R0638:Ifi44l UTSW 3 151762759 missense probably benign 0.13
R1729:Ifi44l UTSW 3 151762819 missense unknown
R3087:Ifi44l UTSW 3 151762857 missense unknown
R4229:Ifi44l UTSW 3 151762877 nonsense probably null
R4230:Ifi44l UTSW 3 151762877 nonsense probably null
R4812:Ifi44l UTSW 3 151759699 missense probably benign 0.00
R5547:Ifi44l UTSW 3 151761505 missense unknown
R7065:Ifi44l UTSW 3 151759792 missense
Predicted Primers PCR Primer
(F):5'- TGAACCCACCTTGACCTAATTC -3'
(R):5'- TGGTGCAGTAGCCATATTTCTCAC -3'

Sequencing Primer
(F):5'- ACACACACTAAGCTTGAGGAG -3'
(R):5'- ACCAAGTTTTCAGATTTACTGTGAG -3'
Posted On2018-04-27