Incidental Mutation 'R6365:Zbtb17'
ID512623
Institutional Source Beutler Lab
Gene Symbol Zbtb17
Ensembl Gene ENSMUSG00000006215
Gene Namezinc finger and BTB domain containing 17
SynonymsmZ13, Zfp100, Miz1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6365 (G1)
Quality Score125.008
Status Validated
Chromosome4
Chromosomal Location141444654-141467930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141463383 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 171 (G171S)
Ref Sequence ENSEMBL: ENSMUSP00000006377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000006377
AA Change: G171S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215
AA Change: G171S

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144899
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein involved in the regulation of c-myc. The symbol MIZ1 has also been associated with PIAS2 which is a different gene located on chromosome 18. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryonic development of homozygous null mice is severely impaired and death occurs prior to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Zbtb17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Zbtb17 APN 4 141466367 nonsense probably null
IGL01449:Zbtb17 APN 4 141463305 missense probably benign
IGL01835:Zbtb17 APN 4 141465438 critical splice donor site probably null
IGL02141:Zbtb17 APN 4 141464953 missense probably damaging 1.00
IGL02142:Zbtb17 APN 4 141464982 missense probably benign 0.29
IGL02167:Zbtb17 APN 4 141461829 missense possibly damaging 0.94
IGL02388:Zbtb17 APN 4 141461913 missense probably damaging 1.00
IGL02600:Zbtb17 APN 4 141466885 missense possibly damaging 0.50
IGL02617:Zbtb17 APN 4 141465088 missense probably damaging 0.97
IGL03290:Zbtb17 APN 4 141466933 missense probably damaging 1.00
IGL03391:Zbtb17 APN 4 141466758 missense probably damaging 1.00
IGL02799:Zbtb17 UTSW 4 141463380 missense probably benign 0.20
R0698:Zbtb17 UTSW 4 141466096 unclassified probably null
R0736:Zbtb17 UTSW 4 141461786 missense probably damaging 1.00
R1924:Zbtb17 UTSW 4 141464603 missense probably damaging 1.00
R1940:Zbtb17 UTSW 4 141465548 missense possibly damaging 0.83
R2164:Zbtb17 UTSW 4 141464246 missense probably benign
R2517:Zbtb17 UTSW 4 141464585 missense probably damaging 1.00
R3424:Zbtb17 UTSW 4 141464988 missense probably damaging 0.99
R3884:Zbtb17 UTSW 4 141464575 missense probably damaging 1.00
R4609:Zbtb17 UTSW 4 141466498 missense probably damaging 1.00
R5055:Zbtb17 UTSW 4 141466549 missense possibly damaging 0.68
R5327:Zbtb17 UTSW 4 141465631 missense probably benign 0.22
R5363:Zbtb17 UTSW 4 141466761 missense probably benign 0.02
R5987:Zbtb17 UTSW 4 141464817 missense possibly damaging 0.94
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6038:Zbtb17 UTSW 4 141464441 missense probably benign 0.05
R6311:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6320:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6321:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6322:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6337:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6492:Zbtb17 UTSW 4 141463383 missense probably benign 0.00
R6605:Zbtb17 UTSW 4 141464950 missense probably damaging 0.99
R6695:Zbtb17 UTSW 4 141461799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTACCTAGGGGTCCTGAG -3'
(R):5'- CCAGAAACTTATGGGCGTGC -3'

Sequencing Primer
(F):5'- GAGCCTCCTCATTCCTCTGGAG -3'
(R):5'- AACTTATGGGCGTGCATACC -3'
Posted On2018-04-27