Incidental Mutation 'R6365:Atp2a2'
ID512627
Institutional Source Beutler Lab
Gene Symbol Atp2a2
Ensembl Gene ENSMUSG00000029467
Gene NameATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms9530097L16Rik, SERCA2, D5Wsu150e, SERCA2B, sarco/endoplasmic reticulum Ca2+-ATPase 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location122453513-122502225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122461916 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 497 (Y497H)
Ref Sequence ENSEMBL: ENSMUSP00000135935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031423] [ENSMUST00000177974] [ENSMUST00000179939]
Predicted Effect probably benign
Transcript: ENSMUST00000031423
AA Change: Y497H

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031423
Gene: ENSMUSG00000029467
AA Change: Y497H

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 2.1e-66 PFAM
Pfam:Hydrolase 345 714 1.2e-18 PFAM
Pfam:HAD 348 711 1e-18 PFAM
Pfam:Cation_ATPase 418 527 2.5e-24 PFAM
Pfam:Hydrolase_3 682 746 1.9e-7 PFAM
Pfam:Cation_ATPase_C 783 986 2.4e-48 PFAM
transmembrane domain 1015 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177974
AA Change: Y497H

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136104
Gene: ENSMUSG00000029467
AA Change: Y497H

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 5.1e-66 PFAM
Pfam:Hydrolase 345 714 2.7e-18 PFAM
Pfam:HAD 348 711 2.6e-18 PFAM
Pfam:Cation_ATPase 418 527 4.7e-24 PFAM
Pfam:Hydrolase_3 682 746 7.2e-7 PFAM
Pfam:Cation_ATPase_C 783 986 5.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179939
AA Change: Y497H

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135935
Gene: ENSMUSG00000029467
AA Change: Y497H

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 93 341 9e-69 PFAM
Pfam:HAD 348 711 1.2e-16 PFAM
Pfam:Hydrolase_like2 418 527 3.1e-24 PFAM
Pfam:Hydrolase 496 714 8.7e-24 PFAM
Pfam:Hydrolase_3 682 746 3.4e-7 PFAM
Pfam:Cation_ATPase_C 783 986 1.6e-47 PFAM
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted homozygous mutants are embryonic lethal while heterozygotes show reduced blood pressure and mildly impaired cardiac contractility and relaxation. Aged heterozygotes for one targeted mutation develop squamous cell tumors of the forestomach, esophagus, oral mucosa, tongue, and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Atp2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Atp2a2 APN 5 122458083 splice site probably null
IGL01459:Atp2a2 APN 5 122469652 missense probably benign 0.03
IGL01721:Atp2a2 APN 5 122500792 missense possibly damaging 0.89
IGL02614:Atp2a2 APN 5 122489303 missense probably benign 0.00
IGL02616:Atp2a2 APN 5 122461684 missense probably benign 0.07
IGL02826:Atp2a2 APN 5 122489291 missense probably benign 0.03
IGL02876:Atp2a2 APN 5 122466008 missense probably benign 0.18
PIT4458001:Atp2a2 UTSW 5 122457309 nonsense probably null
R0087:Atp2a2 UTSW 5 122460961 missense probably benign 0.02
R0139:Atp2a2 UTSW 5 122491715 missense probably damaging 1.00
R0166:Atp2a2 UTSW 5 122466838 missense possibly damaging 0.69
R0457:Atp2a2 UTSW 5 122469714 missense probably benign
R0658:Atp2a2 UTSW 5 122457633 splice site probably benign
R0815:Atp2a2 UTSW 5 122471236 missense probably benign 0.02
R1282:Atp2a2 UTSW 5 122491754 missense probably benign 0.00
R1538:Atp2a2 UTSW 5 122457377 missense probably damaging 1.00
R1985:Atp2a2 UTSW 5 122466836 missense probably benign 0.03
R2111:Atp2a2 UTSW 5 122459546 missense probably damaging 1.00
R2517:Atp2a2 UTSW 5 122457513 missense probably damaging 0.99
R4225:Atp2a2 UTSW 5 122469726 missense probably benign
R4473:Atp2a2 UTSW 5 122457264 missense probably benign 0.01
R4956:Atp2a2 UTSW 5 122461580 missense probably benign 0.02
R4969:Atp2a2 UTSW 5 122458491 missense possibly damaging 0.95
R5242:Atp2a2 UTSW 5 122461946 missense probably damaging 1.00
R5307:Atp2a2 UTSW 5 122461747 missense probably benign 0.06
R5497:Atp2a2 UTSW 5 122458169 missense probably damaging 1.00
R5536:Atp2a2 UTSW 5 122457182 missense probably benign 0.05
R5629:Atp2a2 UTSW 5 122460096 missense probably damaging 1.00
R5641:Atp2a2 UTSW 5 122457576 missense probably damaging 1.00
R6383:Atp2a2 UTSW 5 122501649 missense probably benign 0.37
R6534:Atp2a2 UTSW 5 122457198 missense possibly damaging 0.73
R7162:Atp2a2 UTSW 5 122489324 missense probably benign 0.00
R7259:Atp2a2 UTSW 5 122466069 missense probably benign 0.27
R7268:Atp2a2 UTSW 5 122467729 missense probably benign 0.00
R7465:Atp2a2 UTSW 5 122461700 missense probably benign
R7489:Atp2a2 UTSW 5 122467767 missense probably benign
R7567:Atp2a2 UTSW 5 122491784 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TGGGTGCACCTATCGATGAC -3'
(R):5'- ACTTCCAAACCAGAGAACACTTTTG -3'

Sequencing Primer
(F):5'- ATCGATGACACCTTCTGGAGC -3'
(R):5'- CTGTTGAGGCTGCCAAAAAGACC -3'
Posted On2018-04-27