Incidental Mutation 'R6365:Or51l4'
ID 512637
Institutional Source Beutler Lab
Gene Symbol Or51l4
Ensembl Gene ENSMUSG00000050281
Gene Name olfactory receptor family 51 subfamily L member 4
Synonyms Olfr630, MOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission 044515-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6365 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103403357-103406557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103404402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 130 (H130L)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
AlphaFold Q9EQQ7
Predicted Effect probably benign
Transcript: ENSMUST00000106880
AA Change: H130L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: H130L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217072
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,330,510 (GRCm39) R1235S probably benign Het
Abca9 T A 11: 110,036,481 (GRCm39) I543F possibly damaging Het
Acot6 A G 12: 84,156,186 (GRCm39) E378G probably benign Het
Adam30 T C 3: 98,068,350 (GRCm39) L61S probably damaging Het
Agap3 T A 5: 24,679,983 (GRCm39) L227Q probably benign Het
Ap5m1 T C 14: 49,316,285 (GRCm39) I285T probably benign Het
Atp2a2 A G 5: 122,599,979 (GRCm39) Y497H probably benign Het
Bace1 C T 9: 45,765,974 (GRCm39) Q17* probably null Het
Calcr T C 6: 3,711,455 (GRCm39) I189V probably benign Het
Cd48 A T 1: 171,509,732 (GRCm39) Q24L probably null Het
Cnga1 T C 5: 72,762,288 (GRCm39) I409V probably benign Het
Ctsd G A 7: 141,939,314 (GRCm39) T37M probably benign Het
Cyp2c29 T C 19: 39,296,198 (GRCm39) S171P probably damaging Het
Dnaaf11 A T 15: 66,325,983 (GRCm39) S197R probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Drd2 A T 9: 49,318,249 (GRCm39) N397I probably damaging Het
Dst A G 1: 34,231,008 (GRCm39) E3045G probably damaging Het
Dzip3 T A 16: 48,751,636 (GRCm39) R764S probably damaging Het
Efcab3 A G 11: 104,815,412 (GRCm39) E3247G unknown Het
Exosc10 T C 4: 148,645,562 (GRCm39) V114A probably benign Het
Fam234a C A 17: 26,439,429 (GRCm39) E32* probably null Het
Fbxw11 C A 11: 32,670,623 (GRCm39) D162E possibly damaging Het
Fcho2 A T 13: 98,926,367 (GRCm39) M72K probably benign Het
Fech T C 18: 64,591,251 (GRCm39) N391S probably benign Het
Foxp2 T C 6: 15,286,684 (GRCm39) L58P probably damaging Het
Gdi2 A G 13: 3,615,093 (GRCm39) D430G possibly damaging Het
Grm8 C T 6: 27,363,226 (GRCm39) C763Y probably damaging Het
H2bc6 C T 13: 23,769,641 (GRCm39) R100H probably benign Het
Hibch T A 1: 52,908,096 (GRCm39) probably null Het
Ifi44l C T 3: 151,467,142 (GRCm39) V63I unknown Het
Igf1r G T 7: 67,839,798 (GRCm39) A702S probably benign Het
Kctd13 G A 7: 126,529,862 (GRCm39) R101Q probably damaging Het
Klhl33 T C 14: 51,129,294 (GRCm39) D645G probably benign Het
Mylk A G 16: 34,680,961 (GRCm39) T74A probably benign Het
Myo1f A G 17: 33,805,090 (GRCm39) S453G probably benign Het
Naxe A G 3: 87,965,298 (GRCm39) V105A probably damaging Het
Nid2 A G 14: 19,853,201 (GRCm39) Y1140C probably damaging Het
Nlrp12 T C 7: 3,288,518 (GRCm39) T665A probably benign Het
Otud7b T G 3: 96,062,567 (GRCm39) I602S probably benign Het
Pakap G T 4: 57,709,675 (GRCm39) G207* probably null Het
Papolg T C 11: 23,832,290 (GRCm39) D166G probably damaging Het
Pbx4 T G 8: 70,324,857 (GRCm39) probably null Het
Pdcd4 T C 19: 53,910,564 (GRCm39) probably null Het
Pde2a C T 7: 101,159,570 (GRCm39) T800I probably damaging Het
Polk A T 13: 96,620,517 (GRCm39) V582E probably damaging Het
Prss40 A G 1: 34,591,598 (GRCm39) probably benign Het
Robo4 G T 9: 37,322,008 (GRCm39) R597L probably benign Het
Scg2 T A 1: 79,413,017 (GRCm39) I529F probably benign Het
Sema7a T C 9: 57,862,188 (GRCm39) F180L probably benign Het
Sowahc T C 10: 59,059,349 (GRCm39) L495P probably damaging Het
Trf A G 9: 103,099,327 (GRCm39) V324A possibly damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vip C T 10: 5,594,021 (GRCm39) R125* probably null Het
Vmn1r159 T A 7: 22,542,826 (GRCm39) T69S probably damaging Het
Vmn1r202 A T 13: 22,686,374 (GRCm39) F14L probably benign Het
Vmn1r53 T C 6: 90,201,241 (GRCm39) N28D probably damaging Het
Vmn2r58 T A 7: 41,513,607 (GRCm39) K345N probably benign Het
Zbtb17 G A 4: 141,190,694 (GRCm39) G171S probably benign Het
Zbtb8os A T 4: 129,236,945 (GRCm39) N120I possibly damaging Het
Zfp959 T A 17: 56,204,785 (GRCm39) L274H probably damaging Het
Other mutations in Or51l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Or51l4 APN 7 103,404,213 (GRCm39) missense probably damaging 1.00
IGL01111:Or51l4 APN 7 103,404,580 (GRCm39) missense probably benign 0.07
IGL02456:Or51l4 APN 7 103,404,700 (GRCm39) missense possibly damaging 0.94
IGL03173:Or51l4 APN 7 103,404,183 (GRCm39) missense probably benign 0.00
R1104:Or51l4 UTSW 7 103,404,183 (GRCm39) missense probably benign 0.00
R1507:Or51l4 UTSW 7 103,404,228 (GRCm39) missense probably benign 0.00
R1695:Or51l4 UTSW 7 103,404,131 (GRCm39) nonsense probably null
R1966:Or51l4 UTSW 7 103,404,375 (GRCm39) missense probably damaging 1.00
R1971:Or51l4 UTSW 7 103,404,527 (GRCm39) nonsense probably null
R2696:Or51l4 UTSW 7 103,404,735 (GRCm39) missense probably damaging 0.96
R4943:Or51l4 UTSW 7 103,404,503 (GRCm39) missense probably benign 0.12
R5622:Or51l4 UTSW 7 103,404,376 (GRCm39) missense probably damaging 0.99
R7592:Or51l4 UTSW 7 103,404,279 (GRCm39) missense probably damaging 1.00
R8146:Or51l4 UTSW 7 103,404,510 (GRCm39) missense probably damaging 1.00
R8283:Or51l4 UTSW 7 103,404,019 (GRCm39) missense possibly damaging 0.51
R8867:Or51l4 UTSW 7 103,403,893 (GRCm39) nonsense probably null
R8875:Or51l4 UTSW 7 103,404,462 (GRCm39) missense probably damaging 1.00
R9658:Or51l4 UTSW 7 103,404,028 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAGCCAGGCGAATCATGTC -3'
(R):5'- ACGAGCCCATGTATTACTTCCTG -3'

Sequencing Primer
(F):5'- GAATCATGTCCTGGTGCAAAC -3'
(R):5'- TCACTCACTGACATGGCCATG -3'
Posted On 2018-04-27