Incidental Mutation 'R6365:Bace1'
ID512642
Institutional Source Beutler Lab
Gene Symbol Bace1
Ensembl Gene ENSMUSG00000032086
Gene Namebeta-site APP cleaving enzyme 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45838580-45864399 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 45854676 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 17 (Q17*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034591] [ENSMUST00000078111]
Predicted Effect probably null
Transcript: ENSMUST00000034591
AA Change: Q134*
SMART Domains Protein: ENSMUSP00000034591
Gene: ENSMUSG00000032086
AA Change: Q134*

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 418 3.1e-46 PFAM
Pfam:TAXi_C 259 417 1.2e-13 PFAM
transmembrane domain 455 477 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078111
AA Change: Q134*
SMART Domains Protein: ENSMUSP00000077249
Gene: ENSMUSG00000032086
AA Change: Q134*

DomainStartEndE-ValueType
low complexity region 27 45 N/A INTRINSIC
Pfam:Asp 74 295 9.5e-34 PFAM
Pfam:TAXi_C 290 383 1.5e-8 PFAM
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159499
SMART Domains Protein: ENSMUSP00000124773
Gene: ENSMUSG00000032086

DomainStartEndE-ValueType
Pfam:Asp 4 61 4.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162559
Predicted Effect probably null
Transcript: ENSMUST00000162587
AA Change: Q17*
SMART Domains Protein: ENSMUSP00000124960
Gene: ENSMUSG00000032086
AA Change: Q17*

DomainStartEndE-ValueType
Pfam:Asp 1 75 3.6e-9 PFAM
Pfam:Asp 78 277 3.3e-22 PFAM
Pfam:TAXi_C 118 276 1.4e-15 PFAM
transmembrane domain 314 336 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216609
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protease. This transmembrane protease catalyzes the first step in the formation of amyloid beta peptide from amyloid precursor protein. Amyloid beta peptides are the main constituent of amyloid beta plaques, which accumulate in the brains of human Alzheimer's disease patients. Homozygous knockout mice for this gene exhibit a wide range of nervous system defects, growth retardation, metabolic abnormalities, and increased neonatal lethality. [provided by RefSeq, Nov 2015]
PHENOTYPE: Some alleles with a targeted mutation exhibit small body size, postnatal lethality, hyperactivity, decreased anxiety, and abnormal APP processing by neurons, while others appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Bace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Bace1 APN 9 45839290 critical splice donor site probably null
IGL03378:Bace1 APN 9 45858901 splice site probably null
R0071:Bace1 UTSW 9 45854699 intron probably benign
R1561:Bace1 UTSW 9 45839194 missense probably benign 0.08
R1819:Bace1 UTSW 9 45857162 missense possibly damaging 0.48
R2097:Bace1 UTSW 9 45860222 missense probably benign 0.00
R4067:Bace1 UTSW 9 45854664 missense probably damaging 1.00
R4864:Bace1 UTSW 9 45854811 missense probably damaging 1.00
R5814:Bace1 UTSW 9 45860264 missense probably damaging 1.00
R5818:Bace1 UTSW 9 45859049 missense possibly damaging 0.94
R6968:Bace1 UTSW 9 45854965 intron probably null
R7188:Bace1 UTSW 9 45856095 missense probably benign
R7517:Bace1 UTSW 9 45860261 missense probably benign 0.32
R7560:Bace1 UTSW 9 45856139 missense possibly damaging 0.50
X0020:Bace1 UTSW 9 45860182 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGACATTCTGCTCTGGGTAAC -3'
(R):5'- CCTTGTGTAGCATGCAGTGAG -3'

Sequencing Primer
(F):5'- AACAGGGCTAGGGTTGTTCAGC -3'
(R):5'- AGGCAACAGGCTTGATTCTC -3'
Posted On2018-04-27