Incidental Mutation 'R6365:Vmn1r202'
ID512654
Institutional Source Beutler Lab
Gene Symbol Vmn1r202
Ensembl Gene ENSMUSG00000094379
Gene Namevomeronasal 1 receptor 202
SynonymsV1ri7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6365 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location22497750-22505381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 22502204 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 14 (F14L)
Ref Sequence ENSEMBL: ENSMUSP00000154314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078642] [ENSMUST00000228020]
Predicted Effect probably benign
Transcript: ENSMUST00000078642
AA Change: F14L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000077711
Gene: ENSMUSG00000094379
AA Change: F14L

DomainStartEndE-ValueType
Pfam:TAS2R 5 301 2.2e-11 PFAM
Pfam:V1R 35 300 5.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228020
AA Change: F14L

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Myo1f A G 17: 33,586,116 S453G probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Vmn1r202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn1r202 APN 13 22501989 missense possibly damaging 0.95
IGL01516:Vmn1r202 APN 13 22501462 missense possibly damaging 0.57
IGL01722:Vmn1r202 APN 13 22501720 missense probably benign 0.00
IGL02641:Vmn1r202 APN 13 22502104 missense probably benign 0.34
IGL02863:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02876:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02891:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL02943:Vmn1r202 APN 13 22502194 missense probably benign 0.01
IGL03057:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03114:Vmn1r202 APN 13 22501330 utr 3 prime probably benign
IGL03143:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03159:Vmn1r202 APN 13 22501470 missense probably benign 0.00
IGL03097:Vmn1r202 UTSW 13 22501470 missense probably benign 0.00
R0611:Vmn1r202 UTSW 13 22501654 missense probably damaging 1.00
R1350:Vmn1r202 UTSW 13 22501716 missense probably benign 0.04
R1666:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1668:Vmn1r202 UTSW 13 22501370 missense possibly damaging 0.94
R1803:Vmn1r202 UTSW 13 22502143 missense probably benign 0.00
R2035:Vmn1r202 UTSW 13 22501602 missense probably damaging 0.98
R2112:Vmn1r202 UTSW 13 22501734 missense possibly damaging 0.76
R2145:Vmn1r202 UTSW 13 22501783 missense possibly damaging 0.79
R3026:Vmn1r202 UTSW 13 22501762 missense probably benign 0.03
R3808:Vmn1r202 UTSW 13 22501900 missense possibly damaging 0.83
R4714:Vmn1r202 UTSW 13 22501807 missense probably damaging 1.00
R5016:Vmn1r202 UTSW 13 22502205 missense probably damaging 1.00
R5124:Vmn1r202 UTSW 13 22501750 missense probably benign 0.01
R6136:Vmn1r202 UTSW 13 22501462 missense possibly damaging 0.90
R6982:Vmn1r202 UTSW 13 22501747 missense probably benign 0.02
R7293:Vmn1r202 UTSW 13 22501702 missense probably benign 0.00
R7502:Vmn1r202 UTSW 13 22502018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATGGCTATGGTTCTGACTCC -3'
(R):5'- TAATCACCATCTCCAGGTCAGC -3'

Sequencing Primer
(F):5'- ATGGCTATGGTTCTGACTCCTATGC -3'
(R):5'- ATCTCCAGGTCAGCGGAAC -3'
Posted On2018-04-27