Incidental Mutation 'R6365:Myo1f'
ID512666
Institutional Source Beutler Lab
Gene Symbol Myo1f
Ensembl Gene ENSMUSG00000024300
Gene Namemyosin IF
SynonymsC330006B10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R6365 (G1)
Quality Score177.009
Status Validated
Chromosome17
Chromosomal Location33555719-33607764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33586116 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 453 (S453G)
Ref Sequence ENSEMBL: ENSMUSP00000134715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087605] [ENSMUST00000173372]
Predicted Effect probably benign
Transcript: ENSMUST00000087605
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084887
Gene: ENSMUSG00000024300
AA Change: S453G

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 717 909 1.7e-51 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 973 987 N/A INTRINSIC
low complexity region 991 1001 N/A INTRINSIC
SH3 1044 1098 2.09e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173372
AA Change: S453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134715
Gene: ENSMUSG00000024300
AA Change: S453G

DomainStartEndE-ValueType
MYSc 11 691 N/A SMART
IQ 692 714 7.57e0 SMART
Pfam:Myosin_TH1 716 780 6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173426
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are molecular motors that use the energy from ATP hydrolysis to generate force on actin filaments. The protein encoded by this gene is an unconventional myosin that may be involved in the intracellular movement of membrane-enclosed compartments. There is evidence to suggest that mutations in this gene can result in hearing loss. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil migration and adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik G T 5: 113,182,644 R1235S probably benign Het
Abca9 T A 11: 110,145,655 I543F possibly damaging Het
Acot6 A G 12: 84,109,412 E378G probably benign Het
Adam30 T C 3: 98,161,034 L61S probably damaging Het
Agap3 T A 5: 24,474,985 L227Q probably benign Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Atp2a2 A G 5: 122,461,916 Y497H probably benign Het
Bace1 C T 9: 45,854,676 Q17* probably null Het
Calcr T C 6: 3,711,455 I189V probably benign Het
Cd48 A T 1: 171,682,164 Q24L probably null Het
Cnga1 T C 5: 72,604,945 I409V probably benign Het
Ctsd G A 7: 142,385,577 T37M probably benign Het
Cyp2c29 T C 19: 39,307,754 S171P probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Drd2 A T 9: 49,406,949 N397I probably damaging Het
Dst A G 1: 34,191,927 E3045G probably damaging Het
Dzip3 T A 16: 48,931,273 R764S probably damaging Het
Exosc10 T C 4: 148,561,105 V114A probably benign Het
Fam234a C A 17: 26,220,455 E32* probably null Het
Fbxw11 C A 11: 32,720,623 D162E possibly damaging Het
Fcho2 A T 13: 98,789,859 M72K probably benign Het
Fech T C 18: 64,458,180 N391S probably benign Het
Foxp2 T C 6: 15,286,685 L58P probably damaging Het
Gdi2 A G 13: 3,565,093 D430G possibly damaging Het
Gm11639 A G 11: 104,924,586 E3247G unknown Het
Grm8 C T 6: 27,363,227 C763Y probably damaging Het
Hibch T A 1: 52,868,937 probably null Het
Hist1h2be C T 13: 23,585,658 R100H probably benign Het
Ifi44l C T 3: 151,761,505 V63I unknown Het
Igf1r G T 7: 68,190,050 A702S probably benign Het
Kctd13 G A 7: 126,930,690 R101Q probably damaging Het
Klhl33 T C 14: 50,891,837 D645G probably benign Het
Lrrc6 A T 15: 66,454,134 S197R probably benign Het
Mylk A G 16: 34,860,591 T74A probably benign Het
Naxe A G 3: 88,057,991 V105A probably damaging Het
Nid2 A G 14: 19,803,133 Y1140C probably damaging Het
Nlrp12 T C 7: 3,239,888 T665A probably benign Het
Olfr630 T A 7: 103,755,195 H130L probably benign Het
Otud7b T G 3: 96,155,250 I602S probably benign Het
Palm2 G T 4: 57,709,675 G207* probably null Het
Papolg T C 11: 23,882,290 D166G probably damaging Het
Pbx4 T G 8: 69,872,207 probably null Het
Pdcd4 T C 19: 53,922,133 probably null Het
Pde2a C T 7: 101,510,363 T800I probably damaging Het
Polk A T 13: 96,484,009 V582E probably damaging Het
Prss40 A G 1: 34,552,517 probably benign Het
Robo4 G T 9: 37,410,712 R597L probably benign Het
Scg2 T A 1: 79,435,300 I529F probably benign Het
Sema7a T C 9: 57,954,905 F180L probably benign Het
Sowahc T C 10: 59,223,527 L495P probably damaging Het
Trf A G 9: 103,222,128 V324A possibly damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vip C T 10: 5,644,021 R125* probably null Het
Vmn1r159 T A 7: 22,843,401 T69S probably damaging Het
Vmn1r202 A T 13: 22,502,204 F14L probably benign Het
Vmn1r53 T C 6: 90,224,259 N28D probably damaging Het
Vmn2r58 T A 7: 41,864,183 K345N probably benign Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zbtb8os A T 4: 129,343,152 N120I possibly damaging Het
Zfp959 T A 17: 55,897,785 L274H probably damaging Het
Other mutations in Myo1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Myo1f APN 17 33581964 missense probably benign 0.01
IGL01019:Myo1f APN 17 33593003 missense possibly damaging 0.93
IGL01524:Myo1f APN 17 33579883 missense probably damaging 1.00
IGL01744:Myo1f APN 17 33583680 splice site probably benign
IGL01951:Myo1f APN 17 33598017 missense possibly damaging 0.64
IGL02132:Myo1f APN 17 33579971 missense probably benign 0.10
IGL02170:Myo1f APN 17 33578272 missense probably benign 0.14
IGL02173:Myo1f APN 17 33607344 missense probably damaging 1.00
IGL02277:Myo1f APN 17 33579861 splice site probably null
IGL02550:Myo1f APN 17 33588142 missense probably damaging 1.00
IGL02550:Myo1f APN 17 33580150 unclassified probably benign
IGL02615:Myo1f APN 17 33604656 missense probably benign
IGL02801:Myo1f APN 17 33578137 missense probably damaging 1.00
IGL02817:Myo1f APN 17 33604558 missense probably benign 0.06
IGL02904:Myo1f APN 17 33585658 nonsense probably null
IGL03056:Myo1f APN 17 33585600 missense probably damaging 1.00
IGL03334:Myo1f APN 17 33598194 missense probably damaging 1.00
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0066:Myo1f UTSW 17 33601703 missense probably damaging 0.98
R0321:Myo1f UTSW 17 33593012 missense probably benign 0.31
R0375:Myo1f UTSW 17 33601956 missense probably benign 0.27
R0487:Myo1f UTSW 17 33578284 missense probably damaging 1.00
R0925:Myo1f UTSW 17 33578133 missense probably damaging 0.96
R1394:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1395:Myo1f UTSW 17 33583740 missense probably damaging 0.96
R1474:Myo1f UTSW 17 33594027 missense possibly damaging 0.77
R1760:Myo1f UTSW 17 33586198 missense probably benign 0.03
R1965:Myo1f UTSW 17 33598172 nonsense probably null
R2409:Myo1f UTSW 17 33576667 missense probably damaging 1.00
R2432:Myo1f UTSW 17 33575849 missense probably damaging 1.00
R4610:Myo1f UTSW 17 33582332 missense probably damaging 1.00
R4785:Myo1f UTSW 17 33598191 missense possibly damaging 0.95
R5239:Myo1f UTSW 17 33601735 missense probably benign 0.00
R5881:Myo1f UTSW 17 33576653 missense probably damaging 1.00
R5881:Myo1f UTSW 17 33580285 missense possibly damaging 0.46
R6160:Myo1f UTSW 17 33604344 missense probably benign
R6210:Myo1f UTSW 17 33601070 missense probably damaging 1.00
R6464:Myo1f UTSW 17 33576647 missense probably damaging 1.00
R6532:Myo1f UTSW 17 33575846 missense probably damaging 1.00
R6678:Myo1f UTSW 17 33575845 missense probably damaging 1.00
R7241:Myo1f UTSW 17 33579928 missense probably damaging 0.99
R7266:Myo1f UTSW 17 33601694 missense probably benign
R7513:Myo1f UTSW 17 33575814 missense probably damaging 1.00
X0028:Myo1f UTSW 17 33576438 missense possibly damaging 0.67
X0065:Myo1f UTSW 17 33601983 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGAGGCACGGATTCCCTG -3'
(R):5'- CCACTTAGAAGGGAGTTCCACG -3'

Sequencing Primer
(F):5'- GATTCCCTGCACGCCAGAAG -3'
(R):5'- GCACCTTGCCTGCATAGTGATG -3'
Posted On2018-04-27