Incidental Mutation 'R6366:Ttll9'
ID512674
Institutional Source Beutler Lab
Gene Symbol Ttll9
Ensembl Gene ENSMUSG00000074673
Gene Nametubulin tyrosine ligase-like family, member 9
Synonyms4930509O20Rik, 1700016F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152962485-153008482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152991605 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 208 (D208Y)
Ref Sequence ENSEMBL: ENSMUSP00000099444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099197] [ENSMUST00000103155] [ENSMUST00000109801] [ENSMUST00000146626] [ENSMUST00000152158] [ENSMUST00000165343]
Predicted Effect probably damaging
Transcript: ENSMUST00000099197
AA Change: D208Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096803
Gene: ENSMUSG00000074673
AA Change: D208Y

DomainStartEndE-ValueType
Pfam:TTL 69 397 2.2e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103155
AA Change: D208Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099444
Gene: ENSMUSG00000074673
AA Change: D208Y

DomainStartEndE-ValueType
Pfam:TTL 67 397 5.3e-88 PFAM
low complexity region 452 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109801
AA Change: D183Y

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105426
Gene: ENSMUSG00000074673
AA Change: D183Y

DomainStartEndE-ValueType
Pfam:TTL 68 222 4.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130021
Predicted Effect probably benign
Transcript: ENSMUST00000146626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151641
Predicted Effect probably benign
Transcript: ENSMUST00000152158
Predicted Effect unknown
Transcript: ENSMUST00000165343
AA Change: K55N
Meta Mutation Damage Score 0.2997 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Ttll9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Ttll9 APN 2 152984260 missense probably damaging 0.99
IGL01107:Ttll9 APN 2 153002889 splice site probably benign
IGL01365:Ttll9 APN 2 153000134 missense possibly damaging 0.87
IGL01751:Ttll9 APN 2 152983105 missense probably damaging 0.99
IGL02264:Ttll9 APN 2 153000135 missense probably damaging 1.00
IGL02477:Ttll9 APN 2 153000197 missense possibly damaging 0.77
IGL02899:Ttll9 APN 2 153002951 missense probably damaging 0.99
I2288:Ttll9 UTSW 2 152972339 splice site probably benign
R0053:Ttll9 UTSW 2 152962506 utr 5 prime probably benign
R0116:Ttll9 UTSW 2 152983134 missense probably damaging 0.99
R0319:Ttll9 UTSW 2 153000098 splice site probably null
R0388:Ttll9 UTSW 2 153000179 missense probably benign
R0556:Ttll9 UTSW 2 152973606 critical splice donor site probably null
R0689:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R1829:Ttll9 UTSW 2 153000236 missense possibly damaging 0.61
R2016:Ttll9 UTSW 2 153002294 missense probably damaging 1.00
R2144:Ttll9 UTSW 2 153003007 missense probably benign
R2229:Ttll9 UTSW 2 152983063 missense probably damaging 0.98
R2309:Ttll9 UTSW 2 152984145 missense probably damaging 1.00
R2314:Ttll9 UTSW 2 152983127 missense probably benign 0.05
R4191:Ttll9 UTSW 2 153003007 missense probably benign
R4539:Ttll9 UTSW 2 152994091 missense probably damaging 1.00
R4866:Ttll9 UTSW 2 153003000 missense probably benign 0.02
R5115:Ttll9 UTSW 2 152989590 intron probably benign
R5279:Ttll9 UTSW 2 152962544 missense possibly damaging 0.80
R5342:Ttll9 UTSW 2 152991652 missense possibly damaging 0.87
R5375:Ttll9 UTSW 2 152984224 missense probably benign 0.13
R5417:Ttll9 UTSW 2 153002992 missense probably benign
R5555:Ttll9 UTSW 2 152990100 critical splice donor site probably null
R5574:Ttll9 UTSW 2 152984248 missense possibly damaging 0.90
R5598:Ttll9 UTSW 2 152984314 missense probably damaging 1.00
R5613:Ttll9 UTSW 2 152973601 frame shift probably null
R6409:Ttll9 UTSW 2 152999341 missense probably damaging 1.00
R6655:Ttll9 UTSW 2 153000303 splice site probably null
R6657:Ttll9 UTSW 2 152984262 missense probably damaging 1.00
R6766:Ttll9 UTSW 2 152999300 nonsense probably null
R7012:Ttll9 UTSW 2 153003062 missense possibly damaging 0.46
R7162:Ttll9 UTSW 2 152989603 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGATGTAAATGCCAATGTCCAC -3'
(R):5'- AGCATAGGGAACAAGTCTCTG -3'

Sequencing Primer
(F):5'- TAGGCTCTGGGATCGAACTAC -3'
(R):5'- CATAGGGAACAAGTCTCTGTTTCTG -3'
Posted On2018-04-27