Incidental Mutation 'R6366:Csmd2'
ID 512681
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 044516-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R6366 (G1)
Quality Score 109.008
Status Not validated
Chromosome 4
Chromosomal Location 127881650-128461449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128377245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2042 (K2042E)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: K2042E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.1315 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,584,766 (GRCm39) F185L probably damaging Het
Ank3 A G 10: 69,835,188 (GRCm39) D131G probably damaging Het
Boc T C 16: 44,308,015 (GRCm39) K947E probably benign Het
Ccdc110 A G 8: 46,396,425 (GRCm39) E772G probably damaging Het
Ccdc7a A G 8: 129,582,473 (GRCm39) V1055A unknown Het
Chd1l A G 3: 97,501,476 (GRCm39) V190A probably benign Het
Chl1 C A 6: 103,706,197 (GRCm39) N396K possibly damaging Het
CN725425 T G 15: 91,131,124 (GRCm39) Y420D possibly damaging Het
Col6a1 A T 10: 76,546,804 (GRCm39) I806N unknown Het
Eif4a1 G T 11: 69,561,781 (GRCm39) D15E probably benign Het
Etfb T C 7: 43,102,365 (GRCm39) L119S probably damaging Het
Fbxo42 T A 4: 140,927,260 (GRCm39) S513R probably benign Het
Gys2 C A 6: 142,409,120 (GRCm39) C45F probably benign Het
Hspa1a G A 17: 35,189,500 (GRCm39) P468S probably damaging Het
Kdm2a G T 19: 4,374,960 (GRCm39) Q724K probably benign Het
Lama3 G T 18: 12,615,194 (GRCm39) G1373W probably damaging Het
Lhx1 A T 11: 84,413,034 (GRCm39) F84Y probably damaging Het
Lpxn G A 19: 12,802,163 (GRCm39) V163M probably benign Het
Lrrc7 T C 3: 157,841,012 (GRCm39) Q1389R probably benign Het
Lrtm2 T C 6: 119,294,238 (GRCm39) R298G probably damaging Het
Ltv1 A G 10: 13,056,739 (GRCm39) V268A probably benign Het
Mgat4d T A 8: 84,095,580 (GRCm39) probably null Het
Mknk2 C A 10: 80,507,767 (GRCm39) R33L probably damaging Het
Ms4a1 A G 19: 11,236,062 (GRCm39) S42P probably damaging Het
Muc16 T C 9: 18,557,340 (GRCm39) I2984M unknown Het
Mup12 A C 4: 60,696,657 (GRCm39) F74V probably damaging Het
Nacad A C 11: 6,551,196 (GRCm39) L665R probably benign Het
Pde6a T A 18: 61,398,142 (GRCm39) probably null Het
Plb1 A G 5: 32,471,429 (GRCm39) N579D possibly damaging Het
Podn T A 4: 107,876,001 (GRCm39) I552F possibly damaging Het
Potefam1 A G 2: 110,999,937 (GRCm39) probably null Het
Pramel32 T A 4: 88,547,102 (GRCm39) I106F probably damaging Het
Prl3b1 A T 13: 27,427,875 (GRCm39) M62L probably benign Het
Ptpn13 G T 5: 103,698,919 (GRCm39) R1134L probably damaging Het
Rpl37 T A 15: 5,147,990 (GRCm39) probably null Het
Samd4 T A 14: 47,311,607 (GRCm39) probably null Het
Sh3rf2 T C 18: 42,286,130 (GRCm39) V541A probably benign Het
Shcbp1 A G 8: 4,799,380 (GRCm39) V335A probably damaging Het
Slc7a7 T C 14: 54,612,057 (GRCm39) Y282C probably damaging Het
Spag7 T C 11: 70,555,418 (GRCm39) K125E possibly damaging Het
Spata31e4 T C 13: 50,855,972 (GRCm39) Y537H probably benign Het
Sptan1 T C 2: 29,910,467 (GRCm39) S1831P possibly damaging Het
Stab1 T C 14: 30,863,395 (GRCm39) K2097R probably benign Het
Stk38 A G 17: 29,193,338 (GRCm39) W364R probably benign Het
Tectb G A 19: 55,170,350 (GRCm39) G67D probably damaging Het
Ttll9 G T 2: 152,833,525 (GRCm39) D208Y probably damaging Het
Tyro3 G A 2: 119,647,156 (GRCm39) D758N probably damaging Het
Tyw1 T C 5: 130,310,792 (GRCm39) probably benign Het
Unc5b C T 10: 60,614,091 (GRCm39) A253T probably benign Het
Wtap A T 17: 13,186,945 (GRCm39) probably null Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,377,266 (GRCm39) missense probably benign 0.03
IGL01098:Csmd2 APN 4 127,952,845 (GRCm39) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,262,923 (GRCm39) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,308,081 (GRCm39) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,308,094 (GRCm39) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,457,098 (GRCm39) nonsense probably null
IGL01670:Csmd2 APN 4 128,407,164 (GRCm39) splice site probably benign
IGL01707:Csmd2 APN 4 128,276,798 (GRCm39) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,374,638 (GRCm39) splice site probably benign
IGL01837:Csmd2 APN 4 128,313,363 (GRCm39) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,453,740 (GRCm39) missense unknown
IGL02013:Csmd2 APN 4 128,215,116 (GRCm39) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,453,672 (GRCm39) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,371,263 (GRCm39) splice site probably benign
IGL02303:Csmd2 APN 4 128,262,801 (GRCm39) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02322:Csmd2 APN 4 128,357,520 (GRCm39) splice site probably benign
IGL02338:Csmd2 APN 4 128,288,859 (GRCm39) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,407,165 (GRCm39) splice site probably benign
IGL02428:Csmd2 APN 4 128,368,609 (GRCm39) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,428,050 (GRCm39) missense probably benign
IGL02701:Csmd2 APN 4 128,389,934 (GRCm39) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,445,868 (GRCm39) splice site probably null
IGL02818:Csmd2 APN 4 128,103,521 (GRCm39) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,415,677 (GRCm39) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,215,128 (GRCm39) nonsense probably null
IGL02977:Csmd2 APN 4 128,387,069 (GRCm39) nonsense probably null
IGL03006:Csmd2 APN 4 128,374,558 (GRCm39) splice site probably benign
IGL03032:Csmd2 APN 4 128,412,834 (GRCm39) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,278,062 (GRCm39) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,308,092 (GRCm39) nonsense probably null
IGL03245:Csmd2 APN 4 128,402,915 (GRCm39) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,411,464 (GRCm39) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,190,222 (GRCm39) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,438,536 (GRCm39) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,389,822 (GRCm39) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,415,704 (GRCm39) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,027,466 (GRCm39) intron probably benign
R0441:Csmd2 UTSW 4 128,414,023 (GRCm39) missense probably benign 0.00
R0519:Csmd2 UTSW 4 128,380,798 (GRCm39) missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128,007,469 (GRCm39) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,308,090 (GRCm39) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,389,981 (GRCm39) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,415,807 (GRCm39) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,380,794 (GRCm39) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,377,188 (GRCm39) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,389,988 (GRCm39) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,308,185 (GRCm39) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2870:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2871:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2872:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2873:Csmd2 UTSW 4 128,451,511 (GRCm39) missense unknown
R2893:Csmd2 UTSW 4 128,432,786 (GRCm39) splice site probably null
R3796:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,411,388 (GRCm39) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,215,117 (GRCm39) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,404,717 (GRCm39) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,275,738 (GRCm39) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,373,888 (GRCm39) splice site probably null
R4581:Csmd2 UTSW 4 128,262,881 (GRCm39) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,881,921 (GRCm39) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,439,866 (GRCm39) missense probably benign
R4706:Csmd2 UTSW 4 128,438,544 (GRCm39) missense probably benign
R4776:Csmd2 UTSW 4 128,336,685 (GRCm39) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,411,542 (GRCm39) missense probably benign
R4900:Csmd2 UTSW 4 128,346,318 (GRCm39) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,415,723 (GRCm39) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,215,141 (GRCm39) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 127,952,901 (GRCm39) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,445,828 (GRCm39) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,371,190 (GRCm39) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,439,842 (GRCm39) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,350,707 (GRCm39) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,380,677 (GRCm39) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,442,612 (GRCm39) missense probably benign
R5551:Csmd2 UTSW 4 128,404,741 (GRCm39) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,356,682 (GRCm39) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,412,992 (GRCm39) splice site probably null
R5907:Csmd2 UTSW 4 128,091,178 (GRCm39) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,445,781 (GRCm39) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,439,944 (GRCm39) missense probably benign 0.00
R5977:Csmd2 UTSW 4 127,952,827 (GRCm39) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,453,739 (GRCm39) missense unknown
R6075:Csmd2 UTSW 4 128,380,658 (GRCm39) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,387,127 (GRCm39) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,294,172 (GRCm39) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,415,743 (GRCm39) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,881,893 (GRCm39) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,288,757 (GRCm39) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,266,390 (GRCm39) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,457,164 (GRCm39) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,357,606 (GRCm39) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,091,018 (GRCm39) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,277,743 (GRCm39) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,402,952 (GRCm39) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,357,587 (GRCm39) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,336,633 (GRCm39) missense probably benign
R6882:Csmd2 UTSW 4 128,343,062 (GRCm39) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,262,856 (GRCm39) missense
R7028:Csmd2 UTSW 4 128,171,021 (GRCm39) missense
R7096:Csmd2 UTSW 4 128,356,519 (GRCm39) missense
R7122:Csmd2 UTSW 4 128,343,020 (GRCm39) missense
R7125:Csmd2 UTSW 4 128,389,955 (GRCm39) missense
R7197:Csmd2 UTSW 4 128,404,826 (GRCm39) missense
R7234:Csmd2 UTSW 4 128,350,572 (GRCm39) missense
R7299:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7301:Csmd2 UTSW 4 128,422,055 (GRCm39) missense
R7319:Csmd2 UTSW 4 128,287,472 (GRCm39) missense
R7331:Csmd2 UTSW 4 128,458,021 (GRCm39) splice site probably null
R7332:Csmd2 UTSW 4 128,313,360 (GRCm39) missense
R7352:Csmd2 UTSW 4 128,451,429 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,889 (GRCm39) missense
R7402:Csmd2 UTSW 4 128,215,888 (GRCm39) missense
R7474:Csmd2 UTSW 4 128,439,920 (GRCm39) missense
R7555:Csmd2 UTSW 4 128,346,251 (GRCm39) missense
R7592:Csmd2 UTSW 4 128,357,591 (GRCm39) missense
R7700:Csmd2 UTSW 4 128,439,549 (GRCm39) splice site probably null
R7714:Csmd2 UTSW 4 128,276,743 (GRCm39) nonsense probably null
R7734:Csmd2 UTSW 4 128,445,850 (GRCm39) missense
R7735:Csmd2 UTSW 4 128,350,723 (GRCm39) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,377,249 (GRCm39) missense
R7805:Csmd2 UTSW 4 128,313,366 (GRCm39) missense
R7823:Csmd2 UTSW 4 128,103,698 (GRCm39) missense
R7904:Csmd2 UTSW 4 128,313,346 (GRCm39) missense
R7946:Csmd2 UTSW 4 128,414,058 (GRCm39) missense
R7964:Csmd2 UTSW 4 128,417,303 (GRCm39) missense
R7968:Csmd2 UTSW 4 128,091,118 (GRCm39) missense
R8003:Csmd2 UTSW 4 128,432,980 (GRCm39) nonsense probably null
R8071:Csmd2 UTSW 4 128,287,331 (GRCm39) missense
R8504:Csmd2 UTSW 4 128,440,483 (GRCm39) missense
R8511:Csmd2 UTSW 4 128,262,692 (GRCm39) missense
R8517:Csmd2 UTSW 4 128,446,479 (GRCm39) missense
R8704:Csmd2 UTSW 4 128,091,147 (GRCm39) missense
R8722:Csmd2 UTSW 4 128,445,743 (GRCm39) unclassified probably benign
R8729:Csmd2 UTSW 4 128,356,638 (GRCm39) missense
R8801:Csmd2 UTSW 4 128,457,195 (GRCm39) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,440,477 (GRCm39) missense
R8839:Csmd2 UTSW 4 128,336,681 (GRCm39) missense
R8867:Csmd2 UTSW 4 128,451,469 (GRCm39) missense
R8913:Csmd2 UTSW 4 128,417,351 (GRCm39) missense
R8928:Csmd2 UTSW 4 128,369,582 (GRCm39) missense
R8974:Csmd2 UTSW 4 128,446,380 (GRCm39) missense
R9001:Csmd2 UTSW 4 128,308,079 (GRCm39) missense
R9132:Csmd2 UTSW 4 128,443,007 (GRCm39) missense
R9245:Csmd2 UTSW 4 128,200,168 (GRCm39) missense
R9249:Csmd2 UTSW 4 128,313,323 (GRCm39) nonsense probably null
R9254:Csmd2 UTSW 4 128,091,112 (GRCm39) missense
R9265:Csmd2 UTSW 4 128,294,163 (GRCm39) missense
R9407:Csmd2 UTSW 4 128,442,613 (GRCm39) missense
R9432:Csmd2 UTSW 4 128,171,004 (GRCm39) missense
R9559:Csmd2 UTSW 4 128,438,561 (GRCm39) missense
R9673:Csmd2 UTSW 4 128,308,062 (GRCm39) missense
R9735:Csmd2 UTSW 4 128,402,901 (GRCm39) missense
R9749:Csmd2 UTSW 4 128,389,921 (GRCm39) missense
R9803:Csmd2 UTSW 4 128,262,986 (GRCm39) missense
Z1177:Csmd2 UTSW 4 128,424,590 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGGACCTGTTTTAAAATGTGGC -3'
(R):5'- AGGGCTCAAATTATGGTAACCC -3'

Sequencing Primer
(F):5'- TAAAATGTGGCTCTGGACCC -3'
(R):5'- GGGCTCAAATTATGGTAACCCTTAAC -3'
Posted On 2018-04-27