Incidental Mutation 'R6366:Plb1'
ID512683
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32314085 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 579 (N579D)
Ref Sequence ENSEMBL: ENSMUSP00000144040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202201] [ENSMUST00000202220]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101376
AA Change: N579D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: N579D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118876
Predicted Effect possibly damaging
Transcript: ENSMUST00000202201
AA Change: N579D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144401
Gene: ENSMUSG00000029134
AA Change: N579D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202220
AA Change: N579D

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: N579D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202886
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1428:Plb1 UTSW 5 32264912 missense possibly damaging 0.82
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1804:Plb1 UTSW 5 32353697 missense possibly damaging 0.91
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4739:Plb1 UTSW 5 32349679 splice site probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
R7162:Plb1 UTSW 5 32349663 missense probably benign 0.30
R7379:Plb1 UTSW 5 32345639 missense probably damaging 1.00
R7395:Plb1 UTSW 5 32353684 missense probably benign 0.30
R7643:Plb1 UTSW 5 32247557 nonsense probably null
R7657:Plb1 UTSW 5 32329867 missense probably damaging 0.98
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAACTCTGAGCTCTAGCCCC -3'
(R):5'- CAGAGACTCCTTATGTGCGC -3'

Sequencing Primer
(F):5'- TGAGCTCTAGCCCCCATGTG -3'
(R):5'- TCTCAGAGAGACTGCTGAGGTC -3'
Posted On2018-04-27