Incidental Mutation 'R6366:Tyw1'
ID512685
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 130281951 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213] [ENSMUST00000044204] [ENSMUST00000100662]
Predicted Effect probably benign
Transcript: ENSMUST00000040213
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000044204
AA Change: F414L
SMART Domains Protein: ENSMUSP00000047318
Gene: ENSMUSG00000056310
AA Change: F414L

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.5e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
transmembrane domain 375 397 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100662
SMART Domains Protein: ENSMUSP00000098226
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 4.9e-28 PFAM
low complexity region 276 288 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173375
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4412:Tyw1 UTSW 5 130335232 splice site probably null
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8196:Tyw1 UTSW 5 130300021 missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCTGTGAGTGACAACGAG -3'
(R):5'- TGTCTTCCAGAGAGGGATCC -3'

Sequencing Primer
(F):5'- AGATTGAGCAAAGGGGTTCATTTTTC -3'
(R):5'- GGATCCTCAAGTCAGACTGTG -3'
Posted On2018-04-27