Mutagenetix > Incidental Mutations

Incidental Mutation 'R6366:Chl1'

512686

Institutional Source

Beutler Lab

Gene Symbol

Chl1

Ensembl Gene

ENSMUSG00000030077

Gene Name

cell adhesion molecule L1-like

Synonyms

A530023M13Rik, LICAM2, close homolog of L1, CALL

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.591) question?

Stock #

R6366 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103510586-103750211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103729236 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 396 (N396K)

Ref Sequence

ENSEMBL: ENSMUSP00000144739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066905] [ENSMUST00000203830] [ENSMUST00000203912] [ENSMUST00000205098]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066905
AA Change: N1177K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000063933
Gene: ENSMUSG00000030077
AA Change: N1177K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203830
AA Change: N1177K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144758
Gene: ENSMUSG00000030077
AA Change: N1177K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	253	317	3.76e-17	SMART
IGc2	343	408	1.61e-7	SMART
IGc2	436	501	1.56e-5	SMART
IG	521	609	6.02e-7	SMART
IG_like	539	598	1.27e-1	SMART
FN3	612	695	2.24e-13	SMART
FN3	712	794	1.92e-3	SMART
FN3	810	901	2.3e-1	SMART
FN3	916	1002	4.09e-7	SMART
transmembrane domain	1082	1104	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1105	1190	3.9e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203912

SMART Domains

Protein: ENSMUSP00000145026
Gene: ENSMUSG00000030077

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
IG_like	48	116	3.14e-2	SMART
IG	138	225	1.36e-5	SMART
IGc2	269	333	3.76e-17	SMART
IGc2	359	424	1.61e-7	SMART
IGc2	452	517	1.56e-5	SMART
IG	537	625	6.02e-7	SMART
IG_like	555	614	1.27e-1	SMART
FN3	628	711	2.24e-13	SMART
FN3	728	810	1.92e-3	SMART
FN3	826	917	2.3e-1	SMART
FN3	932	1018	4.09e-7	SMART
transmembrane domain	1044	1066	N/A	INTRINSIC
Pfam:Bravo_FIGEY	1067	1131	2.5e-12	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205098
AA Change: N396K

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144739
Gene: ENSMUSG00000030077
AA Change: N396K

Domain	Start	End	E-Value	Type
FN3	4	67	4.4e-1	SMART
FN3	83	174	1.2e-3	SMART
FN3	189	275	2.1e-9	SMART
transmembrane domain	301	323	N/A	INTRINSIC
Pfam:Bravo_FIGEY	324	409	3.6e-30	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.0%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the L1 gene family of neural cell adhesion molecules. It is a neural recognition molecule that may be involved in signal transduction pathways. The deletion of one copy of this gene may be responsible for mental defects in patients with 3p- syndrome. This protein may also play a role in the growth of certain cancers. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in enlargement of the lateral ventricles and altered hippocampal mossy fiber organization. Mutant animals exhibit altered exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,169,592		probably null	Het
Agl	A	G	3: 116,791,117	F185L	probably damaging	Het
Ank3	A	G	10: 69,999,358	D131G	probably damaging	Het
Boc	T	C	16: 44,487,652	K947E	probably benign	Het
C87499	T	A	4: 88,628,865	I106F	probably damaging	Het
Ccdc110	A	G	8: 45,943,388	E772G	probably damaging	Het
Ccdc7a	A	G	8: 128,855,992	V1055A	unknown	Het
Chd1l	A	G	3: 97,594,160	V190A	probably benign	Het
CN725425	T	G	15: 91,246,921	Y420D	possibly damaging	Het
Col6a1	A	T	10: 76,710,970	I806N	unknown	Het
Csmd2	A	G	4: 128,483,452	K2042E	probably benign	Het
Eif4a1	G	T	11: 69,670,955	D15E	probably benign	Het
Etfb	T	C	7: 43,452,941	L119S	probably damaging	Het
Fbxo42	T	A	4: 141,199,949	S513R	probably benign	Het
Gm8765	T	C	13: 50,701,936	Y537H	probably benign	Het
Gys2	C	A	6: 142,463,394	C45F	probably benign	Het
Hspa1a	G	A	17: 34,970,524	P468S	probably damaging	Het
Kdm2a	G	T	19: 4,324,932	Q724K	probably benign	Het
Lama3	G	T	18: 12,482,137	G1373W	probably damaging	Het
Lhx1	A	T	11: 84,522,208	F84Y	probably damaging	Het
Lpxn	G	A	19: 12,824,799	V163M	probably benign	Het
Lrrc7	T	C	3: 158,135,375	Q1389R	probably benign	Het
Lrtm2	T	C	6: 119,317,277	R298G	probably damaging	Het
Ltv1	A	G	10: 13,180,995	V268A	probably benign	Het
Mgat4d	T	A	8: 83,368,951		probably null	Het
Mknk2	C	A	10: 80,671,933	R33L	probably damaging	Het
Ms4a1	A	G	19: 11,258,698	S42P	probably damaging	Het
Muc16	T	C	9: 18,646,044	I2984M	unknown	Het
Mup12	A	C	4: 60,740,658	F74V	probably damaging	Het
Nacad	A	C	11: 6,601,196	L665R	probably benign	Het
Pde6a	T	A	18: 61,265,071		probably null	Het
Plb1	A	G	5: 32,314,085	N579D	possibly damaging	Het
Podn	T	A	4: 108,018,804	I552F	possibly damaging	Het
Prl3b1	A	T	13: 27,243,892	M62L	probably benign	Het
Ptpn13	G	T	5: 103,551,053	R1134L	probably damaging	Het
Rpl37	T	A	15: 5,118,508		probably null	Het
Samd4	T	A	14: 47,074,150		probably null	Het
Sh3rf2	T	C	18: 42,153,065	V541A	probably benign	Het
Shcbp1	A	G	8: 4,749,380	V335A	probably damaging	Het
Slc7a7	T	C	14: 54,374,600	Y282C	probably damaging	Het
Spag7	T	C	11: 70,664,592	K125E	possibly damaging	Het
Sptan1	T	C	2: 30,020,455	S1831P	possibly damaging	Het
Stab1	T	C	14: 31,141,438	K2097R	probably benign	Het
Stk38	A	G	17: 28,974,364	W364R	probably benign	Het
Tectb	G	A	19: 55,181,918	G67D	probably damaging	Het
Ttll9	G	T	2: 152,991,605	D208Y	probably damaging	Het
Tyro3	G	A	2: 119,816,675	D758N	probably damaging	Het
Tyw1	T	C	5: 130,281,951		probably benign	Het
Unc5b	C	T	10: 60,778,312	A253T	probably benign	Het
Wtap	A	T	17: 12,968,058		probably null	Het

Other mutations in Chl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Chl1	APN	6	103693061	missense	probably benign	0.08
IGL00786:Chl1	APN	6	103675145	missense	probably damaging	1.00
IGL00959:Chl1	APN	6	103709250	splice site	probably null
IGL01109:Chl1	APN	6	103715393	missense	probably damaging	1.00
IGL01354:Chl1	APN	6	103665853	missense	probably benign	0.01
IGL01367:Chl1	APN	6	103729225	missense	probably benign	0.42
IGL01371:Chl1	APN	6	103715364	missense	probably damaging	1.00
IGL01599:Chl1	APN	6	103708484	missense	probably benign	0.34
IGL01724:Chl1	APN	6	103649573	missense	probably damaging	1.00
IGL02001:Chl1	APN	6	103642056	missense	possibly damaging	0.90
IGL02066:Chl1	APN	6	103698224	missense	probably benign	0.39
IGL02122:Chl1	APN	6	103675137	missense	probably benign	0.39
IGL02340:Chl1	APN	6	103698125	missense	probably damaging	1.00
IGL02420:Chl1	APN	6	103715369	missense	probably damaging	1.00
IGL02421:Chl1	APN	6	103717580	missense	probably damaging	1.00
IGL02429:Chl1	APN	6	103664809	unclassified	probably benign
IGL02825:Chl1	APN	6	103668803	missense	possibly damaging	0.87
IGL02858:Chl1	APN	6	103641988	missense	probably damaging	1.00
IGL03169:Chl1	APN	6	103665967	missense	probably damaging	1.00
IGL03185:Chl1	APN	6	103665863	missense	probably damaging	1.00
IGL03189:Chl1	APN	6	103683207	missense	possibly damaging	0.91
IGL03288:Chl1	APN	6	103675097	missense	probably damaging	1.00
IGL03404:Chl1	APN	6	103693091	missense	probably damaging	1.00
IGL03052:Chl1	UTSW	6	103691667	missense	probably benign	0.01
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0060:Chl1	UTSW	6	103711058	splice site	probably benign
R0062:Chl1	UTSW	6	103749652	missense	unknown
R0314:Chl1	UTSW	6	103647301	missense	probably damaging	1.00
R0322:Chl1	UTSW	6	103701883	splice site	probably benign
R0685:Chl1	UTSW	6	103708542	splice site	probably null
R0702:Chl1	UTSW	6	103706622	missense	probably damaging	1.00
R1056:Chl1	UTSW	6	103675077	missense	possibly damaging	0.66
R1138:Chl1	UTSW	6	103693179	missense	probably benign	0.05
R1483:Chl1	UTSW	6	103647287	missense	probably damaging	1.00
R1571:Chl1	UTSW	6	103708484	missense	probably benign	0.34
R1620:Chl1	UTSW	6	103690242	missense	probably benign	0.00
R1645:Chl1	UTSW	6	103683180	missense	probably benign	0.06
R1773:Chl1	UTSW	6	103647331	critical splice donor site	probably null
R1852:Chl1	UTSW	6	103699159	utr 5 prime	probably null
R1891:Chl1	UTSW	6	103714583	missense	possibly damaging	0.88
R2146:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2147:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2148:Chl1	UTSW	6	103715401	critical splice donor site	probably null
R2163:Chl1	UTSW	6	103711231	missense	probably damaging	1.00
R2291:Chl1	UTSW	6	103715393	missense	probably damaging	1.00
R2920:Chl1	UTSW	6	103695343	missense	probably damaging	1.00
R3611:Chl1	UTSW	6	103698155	missense	probably damaging	1.00
R3979:Chl1	UTSW	6	103715284	nonsense	probably null
R4987:Chl1	UTSW	6	103674977	missense	probably damaging	1.00
R5266:Chl1	UTSW	6	103700543	missense	probably damaging	1.00
R5478:Chl1	UTSW	6	103683221	missense	probably damaging	1.00
R5523:Chl1	UTSW	6	103708714	missense	probably damaging	1.00
R5887:Chl1	UTSW	6	103717604	missense	probably benign	0.00
R5986:Chl1	UTSW	6	103709191	missense	probably benign	0.45
R6101:Chl1	UTSW	6	103693032	missense	probably damaging	0.96
R6179:Chl1	UTSW	6	103683243	missense	probably benign	0.38
R6634:Chl1	UTSW	6	103690259	missense	probably damaging	1.00
R6824:Chl1	UTSW	6	103714549	missense	probably damaging	1.00
R6913:Chl1	UTSW	6	103665948	nonsense	probably null
R7097:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7122:Chl1	UTSW	6	103706448	missense	probably damaging	1.00
R7198:Chl1	UTSW	6	103706556	missense	probably damaging	1.00
R7203:Chl1	UTSW	6	103691674	missense	probably benign	0.13
R7527:Chl1	UTSW	6	103711201	missense	probably damaging	1.00
R7625:Chl1	UTSW	6	103729125	missense	probably damaging	1.00
R7667:Chl1	UTSW	6	103695495	missense	possibly damaging	0.82
R7683:Chl1	UTSW	6	103691652	missense	possibly damaging	0.72
R7712:Chl1	UTSW	6	103711102	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- GAGTAACCTGGATAGTCTAGAACC -3'
(R):5'- GAAGGCAGTGCTATTTCTTTCATC -3'

Sequencing Primer
(F):5'- CTGGATAGTCTAGAACCTATTAGACC -3'
(R):5'- TTGCAGAATATCAACCTCTGGAC -3'

Posted On

2018-04-27