Incidental Mutation 'R6366:Shcbp1'
ID512690
Institutional Source Beutler Lab
Gene Symbol Shcbp1
Ensembl Gene ENSMUSG00000022322
Gene NameShc SH2-domain binding protein 1
SynonymsmPAL
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location4735976-4779567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4749380 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 335 (V335A)
Ref Sequence ENSEMBL: ENSMUSP00000022945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022945]
Predicted Effect probably damaging
Transcript: ENSMUST00000022945
AA Change: V335A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022945
Gene: ENSMUSG00000022322
AA Change: V335A

DomainStartEndE-ValueType
low complexity region 210 219 N/A INTRINSIC
low complexity region 262 275 N/A INTRINSIC
PbH1 428 451 8.61e3 SMART
PbH1 452 473 2.38e3 SMART
PbH1 474 496 9.62e2 SMART
PbH1 497 518 1.07e2 SMART
PbH1 526 548 1.74e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207665
Predicted Effect possibly damaging
Transcript: ENSMUST00000207876
AA Change: V68A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208856
Meta Mutation Damage Score 0.4017 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal viability, fertility and T cell development but show decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Shcbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Shcbp1 APN 8 4754258 nonsense probably null
IGL01330:Shcbp1 APN 8 4736372 missense probably benign 0.00
IGL01878:Shcbp1 APN 8 4749721 missense probably damaging 0.98
IGL02415:Shcbp1 APN 8 4754239 missense possibly damaging 0.93
IGL02559:Shcbp1 APN 8 4749305 missense probably damaging 0.98
IGL03171:Shcbp1 APN 8 4739166 missense probably benign 0.05
IGL03348:Shcbp1 APN 8 4765089 missense probably benign 0.10
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0102:Shcbp1 UTSW 8 4744452 missense probably damaging 1.00
R0729:Shcbp1 UTSW 8 4736297 missense probably benign 0.05
R0743:Shcbp1 UTSW 8 4764906 missense probably benign
R1413:Shcbp1 UTSW 8 4741968 critical splice acceptor site probably null
R1630:Shcbp1 UTSW 8 4748763 nonsense probably null
R1645:Shcbp1 UTSW 8 4749645 missense probably benign 0.00
R3778:Shcbp1 UTSW 8 4736295 missense probably benign 0.01
R4066:Shcbp1 UTSW 8 4748716 missense probably damaging 0.98
R4232:Shcbp1 UTSW 8 4736372 missense probably benign 0.06
R4524:Shcbp1 UTSW 8 4739193 missense probably damaging 1.00
R4552:Shcbp1 UTSW 8 4749779 nonsense probably null
R4623:Shcbp1 UTSW 8 4739178 missense probably damaging 1.00
R4748:Shcbp1 UTSW 8 4744512 missense probably damaging 1.00
R5093:Shcbp1 UTSW 8 4739214 missense possibly damaging 0.68
R5152:Shcbp1 UTSW 8 4736138 missense probably damaging 1.00
R5540:Shcbp1 UTSW 8 4744529 missense probably damaging 1.00
R5758:Shcbp1 UTSW 8 4749355 unclassified probably null
R5878:Shcbp1 UTSW 8 4748742 missense probably benign 0.04
R6062:Shcbp1 UTSW 8 4764905 missense probably benign 0.13
R6394:Shcbp1 UTSW 8 4736176 missense probably damaging 0.99
R6513:Shcbp1 UTSW 8 4744507 missense probably benign
R6696:Shcbp1 UTSW 8 4739262 missense probably damaging 1.00
R7014:Shcbp1 UTSW 8 4754234 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4741876 missense probably damaging 1.00
R7334:Shcbp1 UTSW 8 4754310 missense probably damaging 1.00
R7420:Shcbp1 UTSW 8 4748737 missense probably benign 0.02
R7710:Shcbp1 UTSW 8 4764965 missense probably benign 0.14
R7720:Shcbp1 UTSW 8 4748720 missense probably damaging 1.00
R7756:Shcbp1 UTSW 8 4744545 missense probably damaging 0.97
R7769:Shcbp1 UTSW 8 4739232 missense probably damaging 1.00
X0062:Shcbp1 UTSW 8 4739249 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGCTCTTACAATTTGGATCTCAC -3'
(R):5'- GCTAAAGCTCATTGAGAATCCTTTG -3'

Sequencing Primer
(F):5'- TTTGGATCTCACAGAAAACCAGCTC -3'
(R):5'- AGCTCATTGAGAATCCTTTGTTAAG -3'
Posted On2018-04-27