Incidental Mutation 'R6366:Mgat4d'
ID512692
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene NameMGAT4 family, member C
Synonyms4933434I20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83348471-83382320 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 83368951 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
Predicted Effect probably null
Transcript: ENSMUST00000038692
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139692
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 83354796 missense probably benign 0.21
IGL01634:Mgat4d APN 8 83368116 missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 83368102 missense probably damaging 1.00
IGL02084:Mgat4d APN 8 83368981 missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 83355721 missense possibly damaging 0.94
R1322:Mgat4d UTSW 8 83365725 missense possibly damaging 0.74
R1526:Mgat4d UTSW 8 83369037 missense probably benign 0.25
R1617:Mgat4d UTSW 8 83365711 missense probably damaging 1.00
R2223:Mgat4d UTSW 8 83355672 splice site probably benign
R3157:Mgat4d UTSW 8 83354821 missense probably benign
R3421:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R3422:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R4387:Mgat4d UTSW 8 83371706 missense probably damaging 1.00
R4796:Mgat4d UTSW 8 83358120 missense probably damaging 1.00
R4805:Mgat4d UTSW 8 83358158 splice site probably null
R5054:Mgat4d UTSW 8 83368208 splice site probably null
R6927:Mgat4d UTSW 8 83354867 missense probably benign 0.03
R7053:Mgat4d UTSW 8 83371632 missense probably damaging 0.98
R7554:Mgat4d UTSW 8 83355773 missense probably benign 0.00
R7566:Mgat4d UTSW 8 83358023 missense probably damaging 1.00
R8111:Mgat4d UTSW 8 83368147 missense probably damaging 0.96
Z1176:Mgat4d UTSW 8 83348521 missense probably benign 0.04
Z1176:Mgat4d UTSW 8 83368112 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TCTCAGGGAACTAGAGTTTCAAGG -3'
(R):5'- ACAGGCTCTCCCCATCTGTG -3'

Sequencing Primer
(F):5'- ACTAGGGTACTTGAGTATCTGATCTC -3'
(R):5'- TCTGTGCACCCCCACCAG -3'
Posted On2018-04-27