Mutagenetix > Incidental Mutations

Incidental Mutation 'R6366:Unc5b'

512696

Institutional Source

Beutler Lab

Gene Symbol

Unc5b

Ensembl Gene

ENSMUSG00000020099

Gene Name

unc-5 netrin receptor B

Synonyms

Unc5h2, D10Bwg0792e, 6330415E02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6366 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60762593-60831581 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60778312 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 253 (A253T)

Ref Sequence

ENSEMBL: ENSMUSP00000151251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]

Predicted Effect

probably benign
Transcript: ENSMUST00000077925
AA Change: A253T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: A253T

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
IG_like	54	149	1.71e2	SMART
IGc2	165	232	2.58e-6	SMART
TSP1	249	300	8.21e-15	SMART
TSP1	305	354	2.61e-8	SMART
transmembrane domain	374	396	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
ZU5	541	644	1.91e-56	SMART
DEATH	852	943	5.55e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218316

Predicted Effect

probably benign
Transcript: ENSMUST00000218637
AA Change: A253T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0591

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.0%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	G	2: 111,169,592		probably null	Het
Agl	A	G	3: 116,791,117	F185L	probably damaging	Het
Ank3	A	G	10: 69,999,358	D131G	probably damaging	Het
Boc	T	C	16: 44,487,652	K947E	probably benign	Het
C87499	T	A	4: 88,628,865	I106F	probably damaging	Het
Ccdc110	A	G	8: 45,943,388	E772G	probably damaging	Het
Ccdc7a	A	G	8: 128,855,992	V1055A	unknown	Het
Chd1l	A	G	3: 97,594,160	V190A	probably benign	Het
Chl1	C	A	6: 103,729,236	N396K	possibly damaging	Het
CN725425	T	G	15: 91,246,921	Y420D	possibly damaging	Het
Col6a1	A	T	10: 76,710,970	I806N	unknown	Het
Csmd2	A	G	4: 128,483,452	K2042E	probably benign	Het
Eif4a1	G	T	11: 69,670,955	D15E	probably benign	Het
Etfb	T	C	7: 43,452,941	L119S	probably damaging	Het
Fbxo42	T	A	4: 141,199,949	S513R	probably benign	Het
Gm8765	T	C	13: 50,701,936	Y537H	probably benign	Het
Gys2	C	A	6: 142,463,394	C45F	probably benign	Het
Hspa1a	G	A	17: 34,970,524	P468S	probably damaging	Het
Kdm2a	G	T	19: 4,324,932	Q724K	probably benign	Het
Lama3	G	T	18: 12,482,137	G1373W	probably damaging	Het
Lhx1	A	T	11: 84,522,208	F84Y	probably damaging	Het
Lpxn	G	A	19: 12,824,799	V163M	probably benign	Het
Lrrc7	T	C	3: 158,135,375	Q1389R	probably benign	Het
Lrtm2	T	C	6: 119,317,277	R298G	probably damaging	Het
Ltv1	A	G	10: 13,180,995	V268A	probably benign	Het
Mgat4d	T	A	8: 83,368,951		probably null	Het
Mknk2	C	A	10: 80,671,933	R33L	probably damaging	Het
Ms4a1	A	G	19: 11,258,698	S42P	probably damaging	Het
Muc16	T	C	9: 18,646,044	I2984M	unknown	Het
Mup12	A	C	4: 60,740,658	F74V	probably damaging	Het
Nacad	A	C	11: 6,601,196	L665R	probably benign	Het
Pde6a	T	A	18: 61,265,071		probably null	Het
Plb1	A	G	5: 32,314,085	N579D	possibly damaging	Het
Podn	T	A	4: 108,018,804	I552F	possibly damaging	Het
Prl3b1	A	T	13: 27,243,892	M62L	probably benign	Het
Ptpn13	G	T	5: 103,551,053	R1134L	probably damaging	Het
Rpl37	T	A	15: 5,118,508		probably null	Het
Samd4	T	A	14: 47,074,150		probably null	Het
Sh3rf2	T	C	18: 42,153,065	V541A	probably benign	Het
Shcbp1	A	G	8: 4,749,380	V335A	probably damaging	Het
Slc7a7	T	C	14: 54,374,600	Y282C	probably damaging	Het
Spag7	T	C	11: 70,664,592	K125E	possibly damaging	Het
Sptan1	T	C	2: 30,020,455	S1831P	possibly damaging	Het
Stab1	T	C	14: 31,141,438	K2097R	probably benign	Het
Stk38	A	G	17: 28,974,364	W364R	probably benign	Het
Tectb	G	A	19: 55,181,918	G67D	probably damaging	Het
Ttll9	G	T	2: 152,991,605	D208Y	probably damaging	Het
Tyro3	G	A	2: 119,816,675	D758N	probably damaging	Het
Tyw1	T	C	5: 130,281,951		probably benign	Het
Wtap	A	T	17: 12,968,058		probably null	Het

Other mutations in Unc5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Unc5b	APN	10	60783216	missense	possibly damaging	0.73
IGL00578:Unc5b	APN	10	60767055	missense	probably damaging	1.00
IGL01895:Unc5b	APN	10	60767085	missense	probably damaging	1.00
IGL01955:Unc5b	APN	10	60778255	missense	probably benign	0.30
IGL01980:Unc5b	APN	10	60780187	missense	probably damaging	1.00
IGL02277:Unc5b	APN	10	60774742	missense	probably benign
LCD18:Unc5b	UTSW	10	60786171	intron	probably benign
R0021:Unc5b	UTSW	10	60778919	missense	probably benign	0.17
R0021:Unc5b	UTSW	10	60778919	missense	probably benign	0.17
R0026:Unc5b	UTSW	10	60774592	missense	possibly damaging	0.86
R0147:Unc5b	UTSW	10	60772297	missense	probably damaging	0.96
R0305:Unc5b	UTSW	10	60779658	splice site	probably benign
R0306:Unc5b	UTSW	10	60779658	splice site	probably benign
R0373:Unc5b	UTSW	10	60778940	missense	possibly damaging	0.78
R0662:Unc5b	UTSW	10	60772583	missense	possibly damaging	0.68
R1208:Unc5b	UTSW	10	60766992	missense	probably damaging	1.00
R1208:Unc5b	UTSW	10	60766992	missense	probably damaging	1.00
R1512:Unc5b	UTSW	10	60831475	unclassified	probably benign
R1532:Unc5b	UTSW	10	60769232	missense	probably damaging	0.99
R1916:Unc5b	UTSW	10	60778248	missense	probably damaging	1.00
R1931:Unc5b	UTSW	10	60772569	missense	probably benign	0.30
R1954:Unc5b	UTSW	10	60769265	splice site	probably benign
R2350:Unc5b	UTSW	10	60778200	missense	probably benign	0.04
R3419:Unc5b	UTSW	10	60778814	missense	probably damaging	1.00
R4116:Unc5b	UTSW	10	60774700	missense	probably damaging	0.99
R4258:Unc5b	UTSW	10	60765371	missense	probably damaging	0.99
R4329:Unc5b	UTSW	10	60783190	missense	probably damaging	1.00
R4605:Unc5b	UTSW	10	60774403	missense	probably benign	0.01
R4828:Unc5b	UTSW	10	60772348	missense	possibly damaging	0.90
R5134:Unc5b	UTSW	10	60775100	missense	probably benign	0.09
R5190:Unc5b	UTSW	10	60772293	missense	probably benign	0.04
R5240:Unc5b	UTSW	10	60774640	missense	probably damaging	0.99
R5342:Unc5b	UTSW	10	60778267	nonsense	probably null
R5522:Unc5b	UTSW	10	60778195	missense	possibly damaging	0.91
R5694:Unc5b	UTSW	10	60773747	missense	probably benign	0.02
R5822:Unc5b	UTSW	10	60772527	missense	possibly damaging	0.71
R5909:Unc5b	UTSW	10	60772359	missense	probably damaging	1.00
R6007:Unc5b	UTSW	10	60765360	missense	probably damaging	1.00
R6115:Unc5b	UTSW	10	60777546	missense	probably benign	0.33
R6182:Unc5b	UTSW	10	60765236	missense	probably damaging	1.00
R6187:Unc5b	UTSW	10	60772224	missense	probably damaging	1.00
R6294:Unc5b	UTSW	10	60778331	missense	possibly damaging	0.82
R6319:Unc5b	UTSW	10	60778801	missense	probably damaging	1.00
R6532:Unc5b	UTSW	10	60778828	missense	possibly damaging	0.95
R6827:Unc5b	UTSW	10	60780232	missense	probably benign
R6912:Unc5b	UTSW	10	60831092	missense	probably benign
R7032:Unc5b	UTSW	10	60778808	missense	probably damaging	0.99
R7082:Unc5b	UTSW	10	60775088	missense	probably damaging	0.98
R7089:Unc5b	UTSW	10	60777486	missense	probably damaging	1.00
R7270:Unc5b	UTSW	10	60772223	nonsense	probably null
R7587:Unc5b	UTSW	10	60783120	missense	probably damaging	1.00
R7716:Unc5b	UTSW	10	60777438	missense	probably damaging	1.00
R7750:Unc5b	UTSW	10	60775044	missense	probably benign	0.00
R7810:Unc5b	UTSW	10	60765241	missense	probably benign
R7895:Unc5b	UTSW	10	60779730	missense	possibly damaging	0.65
R7942:Unc5b	UTSW	10	60777543	missense	probably damaging	1.00
R8264:Unc5b	UTSW	10	60768334	missense	probably benign	0.22
RF019:Unc5b	UTSW	10	60783183	missense	probably damaging	1.00
X0027:Unc5b	UTSW	10	60777459	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAAGGTAGTGTCCCAACTC -3'
(R):5'- AGACAGTGACTTCCTAGGCC -3'

Sequencing Primer
(F):5'- GGTAGTGTCCCAACTCCATAC -3'
(R):5'- AGTGACTTCCTAGGCCCTCTCAG -3'

Posted On

2018-04-27