Incidental Mutation 'R6366:Unc5b'
ID512696
Institutional Source Beutler Lab
Gene Symbol Unc5b
Ensembl Gene ENSMUSG00000020099
Gene Nameunc-5 netrin receptor B
SynonymsUnc5h2, D10Bwg0792e, 6330415E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location60762593-60831581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60778312 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 253 (A253T)
Ref Sequence ENSEMBL: ENSMUSP00000151251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077925] [ENSMUST00000218637]
Predicted Effect probably benign
Transcript: ENSMUST00000077925
AA Change: A253T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077080
Gene: ENSMUSG00000020099
AA Change: A253T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG_like 54 149 1.71e2 SMART
IGc2 165 232 2.58e-6 SMART
TSP1 249 300 8.21e-15 SMART
TSP1 305 354 2.61e-8 SMART
transmembrane domain 374 396 N/A INTRINSIC
low complexity region 491 504 N/A INTRINSIC
ZU5 541 644 1.91e-56 SMART
DEATH 852 943 5.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218316
Predicted Effect probably benign
Transcript: ENSMUST00000218637
AA Change: A253T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of receptors. This particular protein mediates the repulsive effect of netrin-1 and is a vascular netrin receptor. This encoded protein is also in a group of proteins called dependence receptors (DpRs) which are involved in pro- and anti-apoptotic processes. Many DpRs are involved in embryogenesis and in cancer progression. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a severely hypomorphic allele exhibit background sensitive lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Unc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Unc5b APN 10 60783216 missense possibly damaging 0.73
IGL00578:Unc5b APN 10 60767055 missense probably damaging 1.00
IGL01895:Unc5b APN 10 60767085 missense probably damaging 1.00
IGL01955:Unc5b APN 10 60778255 missense probably benign 0.30
IGL01980:Unc5b APN 10 60780187 missense probably damaging 1.00
IGL02277:Unc5b APN 10 60774742 missense probably benign
LCD18:Unc5b UTSW 10 60786171 intron probably benign
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0021:Unc5b UTSW 10 60778919 missense probably benign 0.17
R0026:Unc5b UTSW 10 60774592 missense possibly damaging 0.86
R0147:Unc5b UTSW 10 60772297 missense probably damaging 0.96
R0305:Unc5b UTSW 10 60779658 splice site probably benign
R0306:Unc5b UTSW 10 60779658 splice site probably benign
R0373:Unc5b UTSW 10 60778940 missense possibly damaging 0.78
R0662:Unc5b UTSW 10 60772583 missense possibly damaging 0.68
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1208:Unc5b UTSW 10 60766992 missense probably damaging 1.00
R1512:Unc5b UTSW 10 60831475 unclassified probably benign
R1532:Unc5b UTSW 10 60769232 missense probably damaging 0.99
R1916:Unc5b UTSW 10 60778248 missense probably damaging 1.00
R1931:Unc5b UTSW 10 60772569 missense probably benign 0.30
R1954:Unc5b UTSW 10 60769265 splice site probably benign
R2350:Unc5b UTSW 10 60778200 missense probably benign 0.04
R3419:Unc5b UTSW 10 60778814 missense probably damaging 1.00
R4116:Unc5b UTSW 10 60774700 missense probably damaging 0.99
R4258:Unc5b UTSW 10 60765371 missense probably damaging 0.99
R4329:Unc5b UTSW 10 60783190 missense probably damaging 1.00
R4605:Unc5b UTSW 10 60774403 missense probably benign 0.01
R4828:Unc5b UTSW 10 60772348 missense possibly damaging 0.90
R5134:Unc5b UTSW 10 60775100 missense probably benign 0.09
R5190:Unc5b UTSW 10 60772293 missense probably benign 0.04
R5240:Unc5b UTSW 10 60774640 missense probably damaging 0.99
R5342:Unc5b UTSW 10 60778267 nonsense probably null
R5522:Unc5b UTSW 10 60778195 missense possibly damaging 0.91
R5694:Unc5b UTSW 10 60773747 missense probably benign 0.02
R5822:Unc5b UTSW 10 60772527 missense possibly damaging 0.71
R5909:Unc5b UTSW 10 60772359 missense probably damaging 1.00
R6007:Unc5b UTSW 10 60765360 missense probably damaging 1.00
R6115:Unc5b UTSW 10 60777546 missense probably benign 0.33
R6182:Unc5b UTSW 10 60765236 missense probably damaging 1.00
R6187:Unc5b UTSW 10 60772224 missense probably damaging 1.00
R6294:Unc5b UTSW 10 60778331 missense possibly damaging 0.82
R6319:Unc5b UTSW 10 60778801 missense probably damaging 1.00
R6532:Unc5b UTSW 10 60778828 missense possibly damaging 0.95
R6827:Unc5b UTSW 10 60780232 missense probably benign
R6912:Unc5b UTSW 10 60831092 missense probably benign
R7032:Unc5b UTSW 10 60778808 missense probably damaging 0.99
R7082:Unc5b UTSW 10 60775088 missense probably damaging 0.98
R7089:Unc5b UTSW 10 60777486 missense probably damaging 1.00
R7270:Unc5b UTSW 10 60772223 nonsense probably null
R7587:Unc5b UTSW 10 60783120 missense probably damaging 1.00
R7716:Unc5b UTSW 10 60777438 missense probably damaging 1.00
R7750:Unc5b UTSW 10 60775044 missense probably benign 0.00
R7810:Unc5b UTSW 10 60765241 missense probably benign
R7895:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
R7978:Unc5b UTSW 10 60779730 missense possibly damaging 0.65
RF019:Unc5b UTSW 10 60783183 missense probably damaging 1.00
X0027:Unc5b UTSW 10 60777459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAGGTAGTGTCCCAACTC -3'
(R):5'- AGACAGTGACTTCCTAGGCC -3'

Sequencing Primer
(F):5'- GGTAGTGTCCCAACTCCATAC -3'
(R):5'- AGTGACTTCCTAGGCCCTCTCAG -3'
Posted On2018-04-27