Incidental Mutation 'R6366:Ank3'
ID512697
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Nameankyrin 3, epithelial
SynonymsAnkyrin-3, Ankyrin-G, AnkG, Ank-3, 2900054D09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.813) question?
Stock #R6366 (G1)
Quality Score193.009
Status Not validated
Chromosome10
Chromosomal Location69398773-70027438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69999358 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 131 (D131G)
Ref Sequence ENSEMBL: ENSMUSP00000138531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092433] [ENSMUST00000092434] [ENSMUST00000181974] [ENSMUST00000182029] [ENSMUST00000182155] [ENSMUST00000182207] [ENSMUST00000182269] [ENSMUST00000182437] [ENSMUST00000182439] [ENSMUST00000182692] [ENSMUST00000182795] [ENSMUST00000182884] [ENSMUST00000182972] [ENSMUST00000182992] [ENSMUST00000183023] [ENSMUST00000183074] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000183261] [ENSMUST00000185582] [ENSMUST00000218680]
Predicted Effect probably damaging
Transcript: ENSMUST00000047061
AA Change: D613G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601
AA Change: D613G

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000054167
AA Change: D1501G

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601
AA Change: D1501G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
AA Change: D1519G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601
AA Change: D1519G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092432
AA Change: D1522G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601
AA Change: D1522G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092433
AA Change: D673G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090089
Gene: ENSMUSG00000069601
AA Change: D673G

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092434
AA Change: D1540G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601
AA Change: D1540G

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181974
AA Change: D673G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138285
Gene: ENSMUSG00000069601
AA Change: D673G

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 736 756 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182029
AA Change: D673G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138337
Gene: ENSMUSG00000069601
AA Change: D673G

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182155
AA Change: D1501G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601
AA Change: D1501G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182207
AA Change: D131G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138531
Gene: ENSMUSG00000069601
AA Change: D131G

DomainStartEndE-ValueType
DEATH 59 153 5.8e-33 SMART
low complexity region 297 317 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182269
AA Change: D660G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138123
Gene: ENSMUSG00000069601
AA Change: D660G

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 886 895 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 935 947 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182437
AA Change: D660G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138586
Gene: ENSMUSG00000069601
AA Change: D660G

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 869 878 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 918 930 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182439
AA Change: D613G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601
AA Change: D613G

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182606
Predicted Effect probably benign
Transcript: ENSMUST00000182665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182687
Predicted Effect probably damaging
Transcript: ENSMUST00000182692
AA Change: D673G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138623
Gene: ENSMUSG00000069601
AA Change: D673G

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 839 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182795
AA Change: D656G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138413
Gene: ENSMUSG00000069601
AA Change: D656G

DomainStartEndE-ValueType
ZU5 111 215 2.27e-58 SMART
DEATH 584 678 7.66e-33 SMART
low complexity region 719 739 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182884
AA Change: D1540G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601
AA Change: D1540G

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182972
AA Change: D760G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601
AA Change: D760G

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182992
AA Change: D2397G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601
AA Change: D2397G

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183001
Predicted Effect unknown
Transcript: ENSMUST00000183023
AA Change: D332G
SMART Domains Protein: ENSMUSP00000138450
Gene: ENSMUSG00000069601
AA Change: D332G

DomainStartEndE-ValueType
DEATH 260 354 7.66e-33 SMART
low complexity region 395 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183074
AA Change: D660G

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138671
Gene: ENSMUSG00000069601
AA Change: D660G

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1065 1074 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1114 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183148
AA Change: D1488G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601
AA Change: D1488G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
AA Change: D1488G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601
AA Change: D1488G

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183261
AA Change: D660G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138095
Gene: ENSMUSG00000069601
AA Change: D660G

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1082 1091 N/A INTRINSIC
low complexity region 1093 1105 N/A INTRINSIC
low complexity region 1131 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185582
SMART Domains Protein: ENSMUSP00000140724
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 66 94 N/A INTRINSIC
Pfam:Death 138 178 7.4e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186247
AA Change: D2824G
Predicted Effect probably benign
Transcript: ENSMUST00000218680
AA Change: D1533G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1542 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69982205 splice site probably benign
IGL00578:Ank3 APN 10 70002394 missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69874833 missense probably damaging 0.99
IGL01067:Ank3 APN 10 69850196 missense probably damaging 1.00
IGL01483:Ank3 APN 10 69874809 missense probably damaging 1.00
IGL01549:Ank3 APN 10 69932420 missense probably damaging 1.00
IGL01576:Ank3 APN 10 69980291 missense probably damaging 1.00
IGL01601:Ank3 APN 10 70004725 missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69892494 missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69999373 missense probably damaging 1.00
IGL02159:Ank3 APN 10 69808892 missense probably damaging 1.00
IGL02249:Ank3 APN 10 69882370 missense probably damaging 1.00
IGL02942:Ank3 APN 10 69973877 missense probably damaging 1.00
IGL02979:Ank3 APN 10 70002099 missense probably benign 0.01
IGL03379:Ank3 APN 10 69973772 missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69993072 missense
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0172:Ank3 UTSW 10 69976058 missense probably damaging 1.00
R0315:Ank3 UTSW 10 70002517 missense probably damaging 0.98
R0480:Ank3 UTSW 10 69879926 missense probably damaging 0.96
R0485:Ank3 UTSW 10 69882544 missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69882368 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1165:Ank3 UTSW 10 69898302 missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69867460 missense probably damaging 1.00
R1257:Ank3 UTSW 10 69874835 nonsense probably null
R1300:Ank3 UTSW 10 70004665 missense probably benign 0.03
R1391:Ank3 UTSW 10 69534280 missense possibly damaging 0.96
R1549:Ank3 UTSW 10 70001982 missense probably benign 0.18
R1586:Ank3 UTSW 10 69877878 missense probably damaging 0.98
R1619:Ank3 UTSW 10 69879975 missense probably damaging 1.00
R1643:Ank3 UTSW 10 69884802 missense probably benign 0.00
R1874:Ank3 UTSW 10 69898083 missense probably damaging 1.00
R1884:Ank3 UTSW 10 70015592 missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69822337 missense probably damaging 1.00
R1986:Ank3 UTSW 10 69867428 missense probably damaging 1.00
R2051:Ank3 UTSW 10 69898090 missense probably damaging 0.97
R2273:Ank3 UTSW 10 69950942 splice site probably null
R2274:Ank3 UTSW 10 69950942 splice site probably null
R2421:Ank3 UTSW 10 69982204 splice site probably benign
R2434:Ank3 UTSW 10 70002118 missense probably damaging 1.00
R2969:Ank3 UTSW 10 69994395 missense probably damaging 1.00
R3426:Ank3 UTSW 10 69706894 missense probably benign
R3885:Ank3 UTSW 10 69899036 missense probably damaging 1.00
R3936:Ank3 UTSW 10 69879989 nonsense probably null
R4258:Ank3 UTSW 10 70004762 missense probably benign 0.33
R4320:Ank3 UTSW 10 69904246 missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4435:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4486:Ank3 UTSW 10 70001974 missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69898256 missense probably damaging 1.00
R4492:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R4508:Ank3 UTSW 10 69892370 missense probably damaging 1.00
R4561:Ank3 UTSW 10 70002018 missense probably damaging 0.99
R4724:Ank3 UTSW 10 69706858 missense probably benign
R4751:Ank3 UTSW 10 69986206 missense probably benign 0.19
R4790:Ank3 UTSW 10 69988151 nonsense probably null
R4795:Ank3 UTSW 10 69858265 missense probably benign 0.36
R4921:Ank3 UTSW 10 70002109 missense probably damaging 1.00
R4932:Ank3 UTSW 10 69898223 splice site probably null
R4935:Ank3 UTSW 10 69976203 missense probably damaging 0.99
R4946:Ank3 UTSW 10 69898117 missense probably damaging 1.00
R5174:Ank3 UTSW 10 69892379 missense probably damaging 0.99
R5208:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69987108 missense probably benign 0.00
R5255:Ank3 UTSW 10 69885200 missense probably damaging 1.00
R5307:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5308:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69953476 splice site probably null
R5374:Ank3 UTSW 10 69953476 splice site probably null
R5502:Ank3 UTSW 10 69920461 missense probably benign 0.12
R5508:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5509:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5510:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69987427 missense probably damaging 1.00
R5664:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5665:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69893517 missense probably damaging 1.00
R5834:Ank3 UTSW 10 69822257 missense probably damaging 1.00
R5881:Ank3 UTSW 10 69986830 missense probably benign 0.31
R5914:Ank3 UTSW 10 69992944 intron probably benign
R5940:Ank3 UTSW 10 69920486 missense probably benign 0.00
R5952:Ank3 UTSW 10 69986463 missense probably benign 0.07
R5963:Ank3 UTSW 10 69987226 nonsense probably null
R6075:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6076:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6077:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6081:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6092:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69994401 missense probably damaging 0.98
R6135:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69927727 missense probably damaging 1.00
R6248:Ank3 UTSW 10 69973850 missense probably benign 0.10
R6249:Ank3 UTSW 10 69823076 critical splice acceptor site probably null
R6273:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6274:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69991368 intron probably benign
R6298:Ank3 UTSW 10 69850176 missense probably damaging 1.00
R6349:Ank3 UTSW 10 69979439 missense probably damaging 1.00
R6371:Ank3 UTSW 10 69808879 missense probably damaging 1.00
R6459:Ank3 UTSW 10 69991747 intron probably benign
R6489:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6491:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6499:Ank3 UTSW 10 69991744 intron probably benign
R6520:Ank3 UTSW 10 69988387 missense probably damaging 1.00
R6521:Ank3 UTSW 10 69992766 intron probably benign
R6535:Ank3 UTSW 10 69877854 missense probably damaging 1.00
R6548:Ank3 UTSW 10 69892410 missense probably damaging 1.00
R6587:Ank3 UTSW 10 69990152 intron probably benign
R6624:Ank3 UTSW 10 69904468 missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69990244 intron probably benign
R6729:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R6731:Ank3 UTSW 10 70014028 missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69991582 intron probably benign
R6788:Ank3 UTSW 10 70004723 missense probably damaging 1.00
R6846:Ank3 UTSW 10 69824349 missense probably damaging 1.00
R6933:Ank3 UTSW 10 69904212 missense probably damaging 1.00
R7034:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7036:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7132:Ank3 UTSW 10 69989914 missense
R7171:Ank3 UTSW 10 69992481 missense
R7241:Ank3 UTSW 10 69706814 start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69822249 missense unknown
R7445:Ank3 UTSW 10 69992124 missense
R7452:Ank3 UTSW 10 69899051 missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69882527 missense unknown
R7494:Ank3 UTSW 10 69988926 missense
R7512:Ank3 UTSW 10 69990861 missense
R7543:Ank3 UTSW 10 69951016 missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69992572 missense
R7610:Ank3 UTSW 10 69986422 missense
R7673:Ank3 UTSW 10 69990501 missense
R7682:Ank3 UTSW 10 69988235 missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69986904 missense
Predicted Primers PCR Primer
(F):5'- TGATCTGTGATCTGCTCGAGC -3'
(R):5'- AAATCACAGTGCCCGTGGTAG -3'

Sequencing Primer
(F):5'- TCGAGCCGAGCAGCAGTAAG -3'
(R):5'- AGTGTTTTCCTGATTTCATCGAACG -3'
Posted On2018-04-27