Incidental Mutation 'R6366:Eif4a1'
ID512701
Institutional Source Beutler Lab
Gene Symbol Eif4a1
Ensembl Gene ENSMUSG00000059796
Gene Nameeukaryotic translation initiation factor 4A1
Synonymsinitiation factor eIF-4A long form, Eif4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6366 (G1)
Quality Score182.009
Status Not validated
Chromosome11
Chromosomal Location69666936-69672423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69670955 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 15 (D15E)
Ref Sequence ENSEMBL: ENSMUSP00000127034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000018918] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000108654] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018918
SMART Domains Protein: ENSMUSP00000018918
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Lamp 28 326 5.6e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066760
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083928
Predicted Effect silent
Transcript: ENSMUST00000102589
Predicted Effect probably benign
Transcript: ENSMUST00000108654
SMART Domains Protein: ENSMUSP00000104294
Gene: ENSMUSG00000018774

DomainStartEndE-ValueType
Pfam:Lamp 16 335 3.1e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133067
Predicted Effect probably benign
Transcript: ENSMUST00000163666
AA Change: D15E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796
AA Change: D15E

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect probably benign
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
CN725425 T G 15: 91,246,921 Y420D possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in Eif4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Eif4a1 APN 11 69669096 missense probably damaging 0.99
IGL01923:Eif4a1 APN 11 69672303 missense possibly damaging 0.81
Tour UTSW 11 69670664 missense probably damaging 0.99
R0709:Eif4a1 UTSW 11 69670252 missense probably damaging 1.00
R3407:Eif4a1 UTSW 11 69670263 missense probably damaging 1.00
R4361:Eif4a1 UTSW 11 69667464 utr 3 prime probably benign
R4398:Eif4a1 UTSW 11 69669244 missense possibly damaging 0.62
R4896:Eif4a1 UTSW 11 69668597 intron probably benign
R4936:Eif4a1 UTSW 11 69672425 unclassified probably benign
R4941:Eif4a1 UTSW 11 69667814 intron probably benign
R7077:Eif4a1 UTSW 11 69670664 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTCGTTCCAGTTACTCTGCAG -3'
(R):5'- AGTCCTTTACAGCCGCTTGATC -3'

Sequencing Primer
(F):5'- ACTTAGGCACTTCGAGTAACGTG -3'
(R):5'- CGCTTGATCTTAAAGGAGCGTCAC -3'
Posted On2018-04-27