Incidental Mutation 'R6366:CN725425'
ID512710
Institutional Source Beutler Lab
Gene Symbol CN725425
Ensembl Gene ENSMUSG00000078932
Gene NamecDNA sequence CN725425
SynonymsGm5807
MMRRC Submission
Accession Numbers

Ensembl: ENSMUST00000109284; MGI: 3613655

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6366 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location91199494-91260894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91246921 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 420 (Y420D)
Ref Sequence ENSEMBL: ENSMUSP00000140772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109284] [ENSMUST00000190436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109284
AA Change: Y413D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104907
Gene: ENSMUSG00000078932
AA Change: Y413D

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
Pfam:DUF4552 219 643 2.7e-202 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190436
AA Change: Y420D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140772
Gene: ENSMUSG00000078932
AA Change: Y420D

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
Pfam:DUF4552 226 650 1.4e-184 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.0%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A G 2: 111,169,592 probably null Het
Agl A G 3: 116,791,117 F185L probably damaging Het
Ank3 A G 10: 69,999,358 D131G probably damaging Het
Boc T C 16: 44,487,652 K947E probably benign Het
C87499 T A 4: 88,628,865 I106F probably damaging Het
Ccdc110 A G 8: 45,943,388 E772G probably damaging Het
Ccdc7a A G 8: 128,855,992 V1055A unknown Het
Chd1l A G 3: 97,594,160 V190A probably benign Het
Chl1 C A 6: 103,729,236 N396K possibly damaging Het
Col6a1 A T 10: 76,710,970 I806N unknown Het
Csmd2 A G 4: 128,483,452 K2042E probably benign Het
Eif4a1 G T 11: 69,670,955 D15E probably benign Het
Etfb T C 7: 43,452,941 L119S probably damaging Het
Fbxo42 T A 4: 141,199,949 S513R probably benign Het
Gm8765 T C 13: 50,701,936 Y537H probably benign Het
Gys2 C A 6: 142,463,394 C45F probably benign Het
Hspa1a G A 17: 34,970,524 P468S probably damaging Het
Kdm2a G T 19: 4,324,932 Q724K probably benign Het
Lama3 G T 18: 12,482,137 G1373W probably damaging Het
Lhx1 A T 11: 84,522,208 F84Y probably damaging Het
Lpxn G A 19: 12,824,799 V163M probably benign Het
Lrrc7 T C 3: 158,135,375 Q1389R probably benign Het
Lrtm2 T C 6: 119,317,277 R298G probably damaging Het
Ltv1 A G 10: 13,180,995 V268A probably benign Het
Mgat4d T A 8: 83,368,951 probably null Het
Mknk2 C A 10: 80,671,933 R33L probably damaging Het
Ms4a1 A G 19: 11,258,698 S42P probably damaging Het
Muc16 T C 9: 18,646,044 I2984M unknown Het
Mup12 A C 4: 60,740,658 F74V probably damaging Het
Nacad A C 11: 6,601,196 L665R probably benign Het
Pde6a T A 18: 61,265,071 probably null Het
Plb1 A G 5: 32,314,085 N579D possibly damaging Het
Podn T A 4: 108,018,804 I552F possibly damaging Het
Prl3b1 A T 13: 27,243,892 M62L probably benign Het
Ptpn13 G T 5: 103,551,053 R1134L probably damaging Het
Rpl37 T A 15: 5,118,508 probably null Het
Samd4 T A 14: 47,074,150 probably null Het
Sh3rf2 T C 18: 42,153,065 V541A probably benign Het
Shcbp1 A G 8: 4,749,380 V335A probably damaging Het
Slc7a7 T C 14: 54,374,600 Y282C probably damaging Het
Spag7 T C 11: 70,664,592 K125E possibly damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Stab1 T C 14: 31,141,438 K2097R probably benign Het
Stk38 A G 17: 28,974,364 W364R probably benign Het
Tectb G A 19: 55,181,918 G67D probably damaging Het
Ttll9 G T 2: 152,991,605 D208Y probably damaging Het
Tyro3 G A 2: 119,816,675 D758N probably damaging Het
Tyw1 T C 5: 130,281,951 probably benign Het
Unc5b C T 10: 60,778,312 A253T probably benign Het
Wtap A T 17: 12,968,058 probably null Het
Other mutations in CN725425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:CN725425 APN 15 91245752 missense possibly damaging 0.71
IGL02176:CN725425 APN 15 91245821 missense probably benign
3-1:CN725425 UTSW 15 91260521 missense possibly damaging 0.52
R0449:CN725425 UTSW 15 91238944 missense possibly damaging 0.73
R0554:CN725425 UTSW 15 91260763 missense possibly damaging 0.86
R1442:CN725425 UTSW 15 91238955 missense possibly damaging 0.96
R1670:CN725425 UTSW 15 91245815 missense possibly damaging 0.86
R1674:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R2425:CN725425 UTSW 15 91245855 missense probably damaging 0.97
R3966:CN725425 UTSW 15 91242687 critical splice donor site probably null
R4959:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R4973:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R5506:CN725425 UTSW 15 91235826 missense possibly damaging 0.85
R5512:CN725425 UTSW 15 91240756 missense probably benign
R5726:CN725425 UTSW 15 91260503 missense possibly damaging 0.85
R5808:CN725425 UTSW 15 91245644 missense probably benign 0.32
R5820:CN725425 UTSW 15 91260697 missense possibly damaging 0.71
R5945:CN725425 UTSW 15 91245777 missense possibly damaging 0.86
R6441:CN725425 UTSW 15 91235802 missense probably benign 0.33
R6484:CN725425 UTSW 15 91260572 missense probably benign 0.32
R6523:CN725425 UTSW 15 91231581 missense probably benign 0.01
R6721:CN725425 UTSW 15 91231618 missense possibly damaging 0.53
R6901:CN725425 UTSW 15 91240763 missense possibly damaging 0.93
R7341:CN725425 UTSW 15 91242670 missense possibly damaging 0.96
R7654:CN725425 UTSW 15 91239435 missense probably benign 0.04
R7704:CN725425 UTSW 15 91235790 missense possibly damaging 0.86
R7709:CN725425 UTSW 15 91240727 missense probably benign
Z1088:CN725425 UTSW 15 91245762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATTGCACTACATCATGGACCAC -3'
(R):5'- GACTGCAAAGCGAGACAATC -3'

Sequencing Primer
(F):5'- ACCAACTCCCCTCCATGTATC -3'
(R):5'- GCGAGACAATCAACTATTTGTGCC -3'
Posted On2018-04-27