Incidental Mutation 'R6367:Sp110'
ID512724
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R6367 (G1)
Quality Score203.009
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85594292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 97 (V97M)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: V97M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: V97M

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162784
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATCCTGGAAGCTGAGATCAG -3'
(R):5'- CGGTGACTACTCATTCAAACTAACC -3'

Sequencing Primer
(F):5'- TCAGCCAGGATGACGCTTC -3'
(R):5'- GACTACTCATTCAAACTAACCCTCTG -3'
Posted On2018-04-27