Incidental Mutation 'R6367:Ptpru'
ID512738
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6367 (G1)
Quality Score199.009
Status Validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131774352 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1181 (D1181G)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000105987]
Predicted Effect probably benign
Transcript: ENSMUST00000030741
AA Change: D1191G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: D1191G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105987
AA Change: D1181G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: D1181G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127633
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4366001:Ptpru UTSW 4 131799712 missense probably benign 0.03
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R7960:Ptpru UTSW 4 131788509 missense probably benign 0.01
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
R8262:Ptpru UTSW 4 131794963 nonsense probably null
R8276:Ptpru UTSW 4 131779173 missense probably damaging 1.00
R8377:Ptpru UTSW 4 131808335 missense probably damaging 1.00
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCTTCATTGACTCCAGGG -3'
(R):5'- GTCCCAAAGCTCAATCTAGGC -3'

Sequencing Primer
(F):5'- ATTGACTCCAGGGCCCTC -3'
(R):5'- AAAGCTCAATCTAGGCCCTTTGTG -3'
Posted On2018-04-27