Incidental Mutation 'R6367:Plekhm2'
ID512739
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6367 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141639705 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 208 (D208G)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably damaging
Transcript: ENSMUST00000030751
AA Change: D208G

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: D208G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: D208G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: D208G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141844
Meta Mutation Damage Score 0.0816 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TCTGTTCAACTGGGAGGGAG -3'
(R):5'- AGCCTTGTTTGCTGCCTGAC -3'

Sequencing Primer
(F):5'- CAGGCTCAGTCATGCTCAGTTG -3'
(R):5'- AGGCTGCTATCCAACATCTC -3'
Posted On2018-04-27