Incidental Mutation 'R6367:Wbp2'
ID512756
Institutional Source Beutler Lab
Gene Symbol Wbp2
Ensembl Gene ENSMUSG00000034341
Gene NameWW domain binding protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6367 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116078573-116086995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116083915 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 31 (T31N)
Ref Sequence ENSEMBL: ENSMUSP00000102052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000106444]
Predicted Effect probably benign
Transcript: ENSMUST00000074628
AA Change: T31N

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341
AA Change: T31N

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106444
AA Change: T31N

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102052
Gene: ENSMUSG00000034341
AA Change: T31N

DomainStartEndE-ValueType
Pfam:GRAM 1 84 2.3e-19 PFAM
Pfam:WWbp 100 212 5.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146339
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein that is a transcriptional coactivator of estrogen receptor alpha and progesterone receptor. Defects in this gene have been associated with hearing impairment. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a null allele show progressive high-frequency hearing loss, raised auditory brainstem response (ABR) thresholds, reduced ABR amplitudes, swelling of afferent terminals, inner hair cell synapse defects, and altered expression of AMPA receptor subunits and post-synaptic proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Oacyl G T 18: 65,725,444 R207L probably damaging Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Wbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Wbp2 APN 11 116081240 missense possibly damaging 0.46
R0006:Wbp2 UTSW 11 116079788 unclassified probably null
R0565:Wbp2 UTSW 11 116082385 missense possibly damaging 0.80
R1510:Wbp2 UTSW 11 116086882 missense probably benign 0.03
R1733:Wbp2 UTSW 11 116083883 missense probably benign 0.10
R1968:Wbp2 UTSW 11 116082365 missense possibly damaging 0.90
R1989:Wbp2 UTSW 11 116080221 critical splice donor site probably null
R2109:Wbp2 UTSW 11 116080619 nonsense probably null
R2264:Wbp2 UTSW 11 116079598 critical splice acceptor site probably null
R3079:Wbp2 UTSW 11 116079708 unclassified probably null
R4239:Wbp2 UTSW 11 116080547 unclassified probably benign
R4647:Wbp2 UTSW 11 116082381 missense probably benign 0.01
R4831:Wbp2 UTSW 11 116080637 nonsense probably null
R6146:Wbp2 UTSW 11 116083902 missense probably benign 0.07
R6455:Wbp2 UTSW 11 116079753 missense probably damaging 0.98
R6823:Wbp2 UTSW 11 116086910 missense probably benign 0.41
Z1088:Wbp2 UTSW 11 116086913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAATCCAGGATCATGTGACAG -3'
(R):5'- AGACCAGGCTTGTTCCTCTC -3'

Sequencing Primer
(F):5'- TAACAGTCCCCAGGGTTCAG -3'
(R):5'- AGGCTTGTTCCTCTCCATTGGG -3'
Posted On2018-04-27