Mutagenetix > Incidental Mutation

Incidental Mutation 'R6367:Dip2b'

512760

Institutional Source

Beutler Lab

Gene Symbol

Dip2b

Ensembl Gene

ENSMUSG00000023026

Gene Name

disco interacting protein 2 homolog B

Synonyms

MMRRC Submission

044517-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.628) question?

Stock #

R6367 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100038664-100219473 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100115914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 57 (Q57L)

Ref Sequence

ENSEMBL: ENSMUSP00000097777 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100203]

AlphaFold

Q3UH60

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100203
AA Change: Q57L

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Q57L

Domain	Start	End	E-Value	Type
DMAP_binding	12	130	1e-42	SMART
low complexity region	152	168	N/A	INTRINSIC
low complexity region	181	192	N/A	INTRINSIC
Pfam:AMP-binding	341	817	2e-26	PFAM
Pfam:AMP-binding	993	1468	1.8e-64	PFAM
low complexity region	1532	1544	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,216,248	N54D	possibly damaging	Het
Abca4	A	C	3: 122,103,580	Q636P	probably damaging	Het
Agk	T	C	6: 40,386,941	F285S	probably benign	Het
Als2	C	A	1: 59,199,140	V678L	probably benign	Het
Arhgap17	T	C	7: 123,308,363	*231W	probably null	Het
Atp11b	A	G	3: 35,784,537	T89A	probably damaging	Het
Axl	A	T	7: 25,787,433	C50S	probably damaging	Het
Cachd1	A	G	4: 101,002,970	D1246G	probably damaging	Het
Dnah14	A	G	1: 181,755,386		probably null	Het
Enpep	G	T	3: 129,332,081	T134N	possibly damaging	Het
Ets1	C	T	9: 32,733,960	Q168*	probably null	Het
Fanci	T	C	7: 79,426,195	C529R	probably damaging	Het
Fbxw28	A	G	9: 109,339,531		probably null	Het
Gucy2c	C	T	6: 136,709,778	E796K	probably damaging	Het
Igsf9b	G	A	9: 27,309,525	W62*	probably null	Het
Kcng1	C	A	2: 168,262,652	V425L	probably damaging	Het
Kndc1	T	C	7: 139,913,506	S463P	probably damaging	Het
Lrba	G	C	3: 86,368,562	A1746P	probably benign	Het
Mgat4c	G	T	10: 102,385,154		probably null	Het
Nckap1l	G	A	15: 103,475,722	M582I	probably benign	Het
Oacyl	G	T	18: 65,725,444	R207L	probably damaging	Het
Olfr1148	T	C	2: 87,833,593	C185R	probably damaging	Het
Olfr1263	A	G	2: 90,015,016	I29V	probably benign	Het
Olfr164	C	T	16: 19,286,072	V224M	probably damaging	Het
Olfr561	C	A	7: 102,774,829	Q102K	possibly damaging	Het
Pacsin2	C	T	15: 83,381,832	A55T	probably benign	Het
Plekhm2	T	C	4: 141,639,705	D208G	probably damaging	Het
Ptpru	T	C	4: 131,774,352	D1181G	probably benign	Het
Safb	A	G	17: 56,593,845		probably benign	Het
Scp2	T	A	4: 108,112,250	Y35F	probably damaging	Het
Secisbp2	A	G	13: 51,682,141	Y757C	probably damaging	Het
Sp110	C	T	1: 85,594,292	V97M	probably benign	Het
Ssx2ip	A	G	3: 146,419,166	Y82C	probably benign	Het
Svopl	A	T	6: 38,019,679	W288R	possibly damaging	Het
Tdg	T	C	10: 82,647,988	Y345H	possibly damaging	Het
Tmem109	A	G	19: 10,874,363	F53S	possibly damaging	Het
Tpsab1	G	T	17: 25,343,474	T293N	probably damaging	Het
Trpm8	A	G	1: 88,359,683	D796G	probably damaging	Het
Tuba1c	T	C	15: 99,037,453	I265T	probably damaging	Het
Unc80	T	C	1: 66,672,766	V2749A	probably benign	Het
Utrn	A	G	10: 12,747,975	L173P	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wbp2	G	T	11: 116,083,915	T31N	probably benign	Het
Wdr1	G	T	5: 38,545,846	A129D	possibly damaging	Het
Yod1	G	A	1: 130,717,538	G19S	probably damaging	Het

Other mutations in Dip2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Dip2b	APN	15	100174501	missense	probably damaging	1.00
IGL01716:Dip2b	APN	15	100209636	missense	probably benign	0.00
IGL01893:Dip2b	APN	15	100171220	splice site	probably benign
IGL01915:Dip2b	APN	15	100178511	missense	probably damaging	1.00
IGL02125:Dip2b	APN	15	100186250	missense	possibly damaging	0.60
IGL02200:Dip2b	APN	15	100151202	missense	possibly damaging	0.93
IGL02506:Dip2b	APN	15	100157281	missense	probably damaging	1.00
IGL02571:Dip2b	APN	15	100157885	missense	possibly damaging	0.93
IGL02706:Dip2b	APN	15	100215311	missense	probably damaging	0.98
IGL02983:Dip2b	APN	15	100132022	missense	possibly damaging	0.81
IGL03120:Dip2b	APN	15	100203127	splice site	probably benign
IGL03181:Dip2b	APN	15	100215207	missense	probably damaging	0.98
IGL03229:Dip2b	APN	15	100207838	splice site	probably benign
IGL03399:Dip2b	APN	15	100175327	missense	possibly damaging	0.63
PIT4131001:Dip2b	UTSW	15	100202352	missense	probably damaging	1.00
R0009:Dip2b	UTSW	15	100169312	missense	probably damaging	1.00
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0058:Dip2b	UTSW	15	100215240	missense	probably benign	0.03
R0092:Dip2b	UTSW	15	100202265	missense	probably damaging	1.00
R0201:Dip2b	UTSW	15	100186147	missense	probably damaging	0.98
R0359:Dip2b	UTSW	15	100211993	missense	probably damaging	0.98
R0390:Dip2b	UTSW	15	100193913	missense	probably damaging	0.99
R0564:Dip2b	UTSW	15	100162719	nonsense	probably null
R0730:Dip2b	UTSW	15	100171651	missense	probably damaging	1.00
R1144:Dip2b	UTSW	15	100154250	missense	probably benign	0.11
R1200:Dip2b	UTSW	15	100209745	missense	probably benign	0.00
R1506:Dip2b	UTSW	15	100183113	missense	probably damaging	1.00
R1750:Dip2b	UTSW	15	100178466	missense	probably benign
R1760:Dip2b	UTSW	15	100212029	missense	probably damaging	1.00
R1773:Dip2b	UTSW	15	100193961	missense	probably benign	0.00
R1812:Dip2b	UTSW	15	100198938	splice site	probably null
R2264:Dip2b	UTSW	15	100203216	missense	probably benign	0.05
R3105:Dip2b	UTSW	15	100142137	nonsense	probably null
R4029:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4030:Dip2b	UTSW	15	100186172	missense	probably damaging	1.00
R4296:Dip2b	UTSW	15	100181336	missense	probably benign
R4392:Dip2b	UTSW	15	100162036	missense	probably damaging	1.00
R4480:Dip2b	UTSW	15	100186301	missense	probably damaging	0.99
R4564:Dip2b	UTSW	15	100157258	nonsense	probably null
R4605:Dip2b	UTSW	15	100209636	missense	probably benign	0.00
R4606:Dip2b	UTSW	15	100215329	missense	possibly damaging	0.91
R4634:Dip2b	UTSW	15	100160491	missense	probably damaging	1.00
R4667:Dip2b	UTSW	15	100151360	missense	probably benign	0.01
R4739:Dip2b	UTSW	15	100207777	missense	probably damaging	0.98
R4826:Dip2b	UTSW	15	100169281	missense	probably damaging	0.99
R4870:Dip2b	UTSW	15	100195784	splice site	probably null
R4877:Dip2b	UTSW	15	100160529	missense	possibly damaging	0.49
R4932:Dip2b	UTSW	15	100171722	missense	probably damaging	1.00
R5009:Dip2b	UTSW	15	100195784	splice site	probably null
R5169:Dip2b	UTSW	15	100205113	missense	probably damaging	1.00
R5216:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5218:Dip2b	UTSW	15	100154296	missense	probably benign	0.00
R5274:Dip2b	UTSW	15	100212104	missense	possibly damaging	0.54
R5370:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5420:Dip2b	UTSW	15	100205173	intron	probably benign
R5447:Dip2b	UTSW	15	100211986	missense	probably damaging	1.00
R5670:Dip2b	UTSW	15	100190104	missense	possibly damaging	0.80
R5768:Dip2b	UTSW	15	100157945	missense	probably benign	0.32
R5908:Dip2b	UTSW	15	100151184	missense	possibly damaging	0.93
R5957:Dip2b	UTSW	15	100209694	missense	probably benign	0.03
R5987:Dip2b	UTSW	15	100190079	missense	probably damaging	1.00
R6260:Dip2b	UTSW	15	100162702	missense	probably benign	0.05
R6325:Dip2b	UTSW	15	100154282	missense	probably benign	0.00
R6391:Dip2b	UTSW	15	100151276	missense	probably damaging	1.00
R6422:Dip2b	UTSW	15	100199011	missense	probably damaging	0.98
R6818:Dip2b	UTSW	15	100193954	missense	probably benign	0.09
R6922:Dip2b	UTSW	15	100193843	missense	probably benign	0.25
R7002:Dip2b	UTSW	15	100160465	missense	probably benign	0.43
R7076:Dip2b	UTSW	15	100157972	splice site	probably null
R7176:Dip2b	UTSW	15	100169318	missense	probably damaging	1.00
R7255:Dip2b	UTSW	15	100209627	missense	probably benign	0.00
R7463:Dip2b	UTSW	15	100154157	missense	probably benign
R7513:Dip2b	UTSW	15	100207748	splice site	probably null
R7876:Dip2b	UTSW	15	100191041	missense	probably benign	0.02
R8368:Dip2b	UTSW	15	100154243	missense	probably benign	0.00
R9289:Dip2b	UTSW	15	100173271	missense	probably damaging	0.97
R9405:Dip2b	UTSW	15	100195876	missense	probably benign	0.05
R9477:Dip2b	UTSW	15	100038903	missense	probably damaging	1.00
R9485:Dip2b	UTSW	15	100155043	missense	probably benign	0.05
R9533:Dip2b	UTSW	15	100175297	missense	probably benign	0.06
R9581:Dip2b	UTSW	15	100181374	missense	probably damaging	0.99
R9666:Dip2b	UTSW	15	100209580	missense	probably damaging	1.00
X0064:Dip2b	UTSW	15	100115850	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGTACTTCTCTAGCATGC -3'
(R):5'- ATTCTGTCACTGAACCGTCTCAG -3'

Sequencing Primer
(F):5'- TTAGGGGACATCACACAG -3'
(R):5'- CACCCGAGGTCTATGCAAATGG -3'

Posted On

2018-04-27