Incidental Mutation 'R6367:Oacyl'
ID512766
Institutional Source Beutler Lab
Gene Symbol Oacyl
Ensembl Gene ENSMUSG00000046610
Gene NameO-acyltransferase like
Synonyms5330437I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6367 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location65698268-65751601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 65725444 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 207 (R207L)
Ref Sequence ENSEMBL: ENSMUSP00000113626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115097] [ENSMUST00000117694]
Predicted Effect probably damaging
Transcript: ENSMUST00000115097
AA Change: R280L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110749
Gene: ENSMUSG00000046610
AA Change: R280L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
NRF 24 145 3.58e-13 SMART
Blast:NRF 152 191 1e-6 BLAST
Pfam:Acyl_transf_3 274 664 6.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117694
AA Change: R207L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113626
Gene: ENSMUSG00000046610
AA Change: R207L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:NRF 24 118 4e-14 BLAST
Pfam:Acyl_transf_3 201 591 6.7e-23 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,216,248 N54D possibly damaging Het
Abca4 A C 3: 122,103,580 Q636P probably damaging Het
Agk T C 6: 40,386,941 F285S probably benign Het
Als2 C A 1: 59,199,140 V678L probably benign Het
Arhgap17 T C 7: 123,308,363 *231W probably null Het
Atp11b A G 3: 35,784,537 T89A probably damaging Het
Axl A T 7: 25,787,433 C50S probably damaging Het
Cachd1 A G 4: 101,002,970 D1246G probably damaging Het
Dip2b A T 15: 100,115,914 Q57L possibly damaging Het
Dnah14 A G 1: 181,755,386 probably null Het
Enpep G T 3: 129,332,081 T134N possibly damaging Het
Ets1 C T 9: 32,733,960 Q168* probably null Het
Fanci T C 7: 79,426,195 C529R probably damaging Het
Fbxw28 A G 9: 109,339,531 probably null Het
Gucy2c C T 6: 136,709,778 E796K probably damaging Het
Igsf9b G A 9: 27,309,525 W62* probably null Het
Kcng1 C A 2: 168,262,652 V425L probably damaging Het
Kndc1 T C 7: 139,913,506 S463P probably damaging Het
Lrba G C 3: 86,368,562 A1746P probably benign Het
Mgat4c G T 10: 102,385,154 probably null Het
Nckap1l G A 15: 103,475,722 M582I probably benign Het
Olfr1148 T C 2: 87,833,593 C185R probably damaging Het
Olfr1263 A G 2: 90,015,016 I29V probably benign Het
Olfr164 C T 16: 19,286,072 V224M probably damaging Het
Olfr561 C A 7: 102,774,829 Q102K possibly damaging Het
Pacsin2 C T 15: 83,381,832 A55T probably benign Het
Plekhm2 T C 4: 141,639,705 D208G probably damaging Het
Ptpru T C 4: 131,774,352 D1181G probably benign Het
Safb A G 17: 56,593,845 probably benign Het
Scp2 T A 4: 108,112,250 Y35F probably damaging Het
Secisbp2 A G 13: 51,682,141 Y757C probably damaging Het
Sp110 C T 1: 85,594,292 V97M probably benign Het
Ssx2ip A G 3: 146,419,166 Y82C probably benign Het
Svopl A T 6: 38,019,679 W288R possibly damaging Het
Tdg T C 10: 82,647,988 Y345H possibly damaging Het
Tmem109 A G 19: 10,874,363 F53S possibly damaging Het
Tpsab1 G T 17: 25,343,474 T293N probably damaging Het
Trpm8 A G 1: 88,359,683 D796G probably damaging Het
Tuba1c T C 15: 99,037,453 I265T probably damaging Het
Unc80 T C 1: 66,672,766 V2749A probably benign Het
Utrn A G 10: 12,747,975 L173P probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wbp2 G T 11: 116,083,915 T31N probably benign Het
Wdr1 G T 5: 38,545,846 A129D possibly damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Other mutations in Oacyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Oacyl APN 18 65749640 missense possibly damaging 0.65
IGL00972:Oacyl APN 18 65725501 missense possibly damaging 0.95
IGL01970:Oacyl APN 18 65749714 missense possibly damaging 0.77
IGL02030:Oacyl APN 18 65737910 missense probably damaging 0.99
IGL02706:Oacyl APN 18 65749721 missense probably damaging 1.00
R0529:Oacyl UTSW 18 65742219 missense probably damaging 0.97
R0607:Oacyl UTSW 18 65747891 missense possibly damaging 0.61
R0724:Oacyl UTSW 18 65737825 splice site probably benign
R1138:Oacyl UTSW 18 65725450 missense probably damaging 1.00
R1482:Oacyl UTSW 18 65737972 missense probably damaging 1.00
R1551:Oacyl UTSW 18 65742209 missense probably benign 0.02
R1649:Oacyl UTSW 18 65750096 missense probably damaging 1.00
R1919:Oacyl UTSW 18 65710547 missense possibly damaging 0.87
R4271:Oacyl UTSW 18 65737967 missense probably damaging 1.00
R5443:Oacyl UTSW 18 65750182 missense probably benign
R5525:Oacyl UTSW 18 65745356 missense probably benign 0.00
R5879:Oacyl UTSW 18 65749672 missense probably damaging 1.00
R6132:Oacyl UTSW 18 65726355 missense probably damaging 1.00
R7009:Oacyl UTSW 18 65722538 nonsense probably null
R7097:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7122:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7132:Oacyl UTSW 18 65698409 missense probably damaging 1.00
R7260:Oacyl UTSW 18 65698367 missense probably damaging 1.00
R7403:Oacyl UTSW 18 65737895 missense probably benign 0.15
R7501:Oacyl UTSW 18 65725298 splice site probably null
R7759:Oacyl UTSW 18 65710560 missense probably damaging 1.00
R7892:Oacyl UTSW 18 65737847 missense probably benign 0.00
R7921:Oacyl UTSW 18 65725383 missense probably benign
R7977:Oacyl UTSW 18 65698391 missense probably benign 0.18
R7987:Oacyl UTSW 18 65698391 missense probably benign 0.18
Z1177:Oacyl UTSW 18 65725347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCATCCGAAGTTTCTGCATG -3'
(R):5'- AAGGCTGACTGTTCATGAGAC -3'

Sequencing Primer
(F):5'- ATCCGAAGTTTCTGCATGAGTTTTAG -3'
(R):5'- ACTGTTCATGAGACAGCTGTC -3'
Posted On2018-04-27