Incidental Mutation 'R6368:Abi2'
ID512768
Institutional Source Beutler Lab
Gene Symbol Abi2
Ensembl Gene ENSMUSG00000026782
Gene Nameabl-interactor 2
Synonyms8430425M24Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001198570.1, NM_001198571.1, NM_198127.2; Ensembl: ENSMUST00000052332, ENSMUST00000087417

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location60409619-60481158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60453651 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 158 (T158A)
Ref Sequence ENSEMBL: ENSMUSP00000139743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052332] [ENSMUST00000185788] [ENSMUST00000186097] [ENSMUST00000187709] [ENSMUST00000188594] [ENSMUST00000188618] [ENSMUST00000189980] [ENSMUST00000190158]
Predicted Effect probably benign
Transcript: ENSMUST00000052332
AA Change: T294A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000058754
Gene: ENSMUSG00000026782
AA Change: T294A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 168 1.1e-37 PFAM
low complexity region 236 262 N/A INTRINSIC
low complexity region 335 370 N/A INTRINSIC
SH3 387 442 5.55e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000185788
AA Change: T208A
SMART Domains Protein: ENSMUSP00000139483
Gene: ENSMUSG00000026782
AA Change: T208A

DomainStartEndE-ValueType
Pfam:Abi_HHR 1 67 4.4e-25 PFAM
low complexity region 68 81 N/A INTRINSIC
low complexity region 83 115 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
low complexity region 249 284 N/A INTRINSIC
SH3 301 356 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186097
AA Change: T214A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139501
Gene: ENSMUSG00000026782
AA Change: T214A

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 95 121 N/A INTRINSIC
low complexity region 125 143 N/A INTRINSIC
low complexity region 284 319 N/A INTRINSIC
SH3 336 391 3.4e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187400
AA Change: T99A
Predicted Effect probably benign
Transcript: ENSMUST00000187709
AA Change: T294A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139867
Gene: ENSMUSG00000026782
AA Change: T294A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.8e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 236 262 N/A INTRINSIC
low complexity region 364 399 N/A INTRINSIC
SH3 416 471 3.4e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000188594
AA Change: T306A
SMART Domains Protein: ENSMUSP00000140750
Gene: ENSMUSG00000026782
AA Change: T306A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 165 1.7e-33 PFAM
low complexity region 166 179 N/A INTRINSIC
low complexity region 181 213 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 347 382 N/A INTRINSIC
SH3 399 454 3.4e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188618
AA Change: T361A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140274
Gene: ENSMUSG00000026782
AA Change: T361A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5.1e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 272 290 N/A INTRINSIC
low complexity region 402 437 N/A INTRINSIC
SH3 454 487 2.29e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189980
AA Change: T328A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141068
Gene: ENSMUSG00000026782
AA Change: T328A

DomainStartEndE-ValueType
Pfam:Abi_HHR 93 171 5e-37 PFAM
low complexity region 172 185 N/A INTRINSIC
low complexity region 242 268 N/A INTRINSIC
low complexity region 369 404 N/A INTRINSIC
SH3 421 476 5.55e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190158
AA Change: T158A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139743
Gene: ENSMUSG00000026782
AA Change: T158A

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 33 65 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
PDB:4N78|F 88 196 5e-62 PDB
low complexity region 226 261 N/A INTRINSIC
SH3 278 333 3.4e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display microphthalmia, abnormal lens development, abnormal corpus callosum, cerebral cortex, and hippocampus morphology, and impaired contextual conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Ralgps2 A T 1: 156,884,574 L147I probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Abi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Abi2 APN 1 60447346 missense probably damaging 1.00
IGL01369:Abi2 APN 1 60437056 missense probably damaging 1.00
IGL02028:Abi2 APN 1 60434283 missense probably damaging 1.00
IGL02074:Abi2 APN 1 60447307 missense probably damaging 1.00
IGL02897:Abi2 APN 1 60448194 missense probably damaging 0.96
IGL02957:Abi2 APN 1 60470786 missense probably damaging 1.00
1mM(1):Abi2 UTSW 1 60437057 missense probably damaging 1.00
P0026:Abi2 UTSW 1 60453723 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R0062:Abi2 UTSW 1 60453725 missense probably benign 0.42
R3946:Abi2 UTSW 1 60453754 missense probably damaging 1.00
R4793:Abi2 UTSW 1 60409804 start codon destroyed probably null 1.00
R5110:Abi2 UTSW 1 60450121 missense probably benign 0.00
R5557:Abi2 UTSW 1 60438912 unclassified probably benign
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6037:Abi2 UTSW 1 60464579 missense probably damaging 1.00
R6481:Abi2 UTSW 1 60438939 unclassified probably null
R7393:Abi2 UTSW 1 60434382 missense possibly damaging 0.92
R7460:Abi2 UTSW 1 60434307 missense probably damaging 1.00
R7573:Abi2 UTSW 1 60470708 missense probably benign 0.37
R7744:Abi2 UTSW 1 60437203 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTAGCTATACTGGAGACTTGGTG -3'
(R):5'- GATAAACACCTATCATGTATGGGC -3'

Sequencing Primer
(F):5'- GCTTTAATACAGTATCAGCTGTCATC -3'
(R):5'- CACCTATCATGTATGGGCTAATTATG -3'
Posted On2018-04-27