Incidental Mutation 'R6368:Ralgps2'
ID512771
Institutional Source Beutler Lab
Gene Symbol Ralgps2
Ensembl Gene ENSMUSG00000026594
Gene NameRal GEF with PH domain and SH3 binding motif 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6368 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156804166-156939626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 156884574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 147 (L147I)
Ref Sequence ENSEMBL: ENSMUSP00000139645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000190762] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably damaging
Transcript: ENSMUST00000027886
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063199
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171292
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172057
AA Change: L112I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594
AA Change: L112I

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185198
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188656
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189316
AA Change: L147I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190648
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190762
SMART Domains Protein: ENSMUSP00000139822
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:RasGEF 46 128 3e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191605
AA Change: L147I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594
AA Change: L147I

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik C A 9: 55,990,132 E272D possibly damaging Het
Abi2 A G 1: 60,453,651 T158A possibly damaging Het
Acacb T C 5: 114,216,823 S1221P probably damaging Het
Agbl1 A G 7: 76,419,830 D370G probably benign Het
Apeh A G 9: 108,087,243 I487T probably damaging Het
Arid1b C A 17: 5,332,533 N1297K possibly damaging Het
Ascc3 G A 10: 50,699,985 G779S probably damaging Het
Atp7b A C 8: 22,020,755 probably null Het
Bsn C T 9: 108,111,314 probably benign Het
Caps2 C T 10: 112,194,968 Q268* probably null Het
Cnfn C T 7: 25,367,961 probably null Het
Cr2 A G 1: 195,168,472 S229P probably damaging Het
Cubn T C 2: 13,430,995 Y1050C probably damaging Het
Cubn T C 2: 13,476,123 E307G probably damaging Het
Cyb5r3 A C 15: 83,160,124 Y182D possibly damaging Het
Dclre1a A T 19: 56,546,791 H120Q probably benign Het
Ddx6 T C 9: 44,635,776 I457T probably damaging Het
E2f1 A T 2: 154,564,476 H93Q possibly damaging Het
Fam186a T C 15: 99,943,317 K1682R possibly damaging Het
Farsb A G 1: 78,466,965 probably null Het
Flii A T 11: 60,721,136 L347Q probably damaging Het
Galntl6 T G 8: 58,911,441 T12P probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm21680 T C 5: 25,969,036 N190S probably damaging Het
Ifit1bl2 T C 19: 34,619,125 S364G probably benign Het
Kdm2a A G 19: 4,350,317 I234T probably damaging Het
Kdm5b T C 1: 134,599,207 C356R probably damaging Het
Kel A T 6: 41,688,851 C174* probably null Het
Krt16 T A 11: 100,246,676 D401V probably damaging Het
Ltb4r1 A C 14: 55,767,743 I168L probably benign Het
Luzp1 T A 4: 136,541,780 M438K probably benign Het
Mtf1 C T 4: 124,824,352 T281M probably damaging Het
Myo9a T A 9: 59,924,948 S2587T probably benign Het
Olfr1311 A T 2: 112,021,551 I101N probably damaging Het
Olfr1377 T A 11: 50,984,786 F28L probably benign Het
Olfr532 G T 7: 140,419,667 Y35* probably null Het
Olfr860 T C 9: 19,846,409 D70G probably damaging Het
Pcm1 T A 8: 41,293,544 F1221Y probably benign Het
Pnldc1 A T 17: 12,905,864 N90K probably damaging Het
Prickle2 A T 6: 92,420,237 L169Q probably damaging Het
Rfx3 A T 19: 27,768,609 L674Q possibly damaging Het
Rpl3 C A 15: 80,082,544 L14F probably damaging Het
Rrbp1 C T 2: 143,989,555 G231R probably damaging Het
Sema3d C T 5: 12,571,013 L529F probably damaging Het
Slain1 A T 14: 103,656,955 T193S probably benign Het
Slc2a6 G T 2: 27,024,587 Q256K possibly damaging Het
Slk A G 19: 47,620,183 E525G possibly damaging Het
Spsb4 G T 9: 96,944,645 Q252K probably benign Het
Taf1b A G 12: 24,558,257 T552A possibly damaging Het
Tmprss15 T C 16: 79,006,057 probably null Het
Tph2 T C 10: 115,179,326 H177R probably damaging Het
Ttll1 A G 15: 83,489,617 S332P probably damaging Het
Twf2 T G 9: 106,212,833 N128K probably benign Het
Vegfc T A 8: 54,181,230 C315S probably damaging Het
Vmn2r111 T A 17: 22,571,908 K136N probably benign Het
Wnk2 T C 13: 49,061,338 E496G probably damaging Het
Zfp148 C A 16: 33,497,198 Q705K probably damaging Het
Zw10 C T 9: 49,073,235 A539V probably damaging Het
Other mutations in Ralgps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02406:Ralgps2 APN 1 156828268 missense possibly damaging 0.49
IGL02669:Ralgps2 APN 1 156832698 missense probably damaging 1.00
IGL02898:Ralgps2 APN 1 156817744 missense probably benign 0.13
R0164:Ralgps2 UTSW 1 156887089 critical splice donor site probably null
R0164:Ralgps2 UTSW 1 156887089 critical splice donor site probably null
R0295:Ralgps2 UTSW 1 156823985 splice site probably benign
R0551:Ralgps2 UTSW 1 156832663 critical splice donor site probably null
R1179:Ralgps2 UTSW 1 156901799 missense probably damaging 1.00
R1573:Ralgps2 UTSW 1 156832930 missense possibly damaging 0.85
R2112:Ralgps2 UTSW 1 156832708 missense probably damaging 1.00
R4832:Ralgps2 UTSW 1 156857067 intron probably benign
R5316:Ralgps2 UTSW 1 156813497 missense probably damaging 0.99
R5762:Ralgps2 UTSW 1 156832664 critical splice donor site probably null
R6572:Ralgps2 UTSW 1 156824050 splice site probably null
R6777:Ralgps2 UTSW 1 156887945 critical splice donor site probably null
R7165:Ralgps2 UTSW 1 156828248 missense probably benign 0.05
X0020:Ralgps2 UTSW 1 156819892 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CATTCCCTCAAAAGCTCAGTGC -3'
(R):5'- GACAGTTTCCAAAAGTGACAGTAAC -3'

Sequencing Primer
(F):5'- TGTTGGTTTCAAAGAACAAAGTGC -3'
(R):5'- CCACTGCCTAAATTGTGC -3'
Posted On2018-04-27